Transcript: Human NM_001040260.4

Homo sapiens doublecortin like kinase 2 (DCLK2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
DCLK2 (166614)
Length:
4075
CDS:
584..2884

Additional Resources:

NCBI RefSeq record:
NM_001040260.4
NBCI Gene record:
DCLK2 (166614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040260.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001971 GCCGAGTGAAACATCCCAATA pLKO.1 1917 CDS 100% 10.800 15.120 N DCLK2 n/a
2 TRCN0000315169 TCCAATGAACCATTTCGTAAA pLKO_005 1025 CDS 100% 10.800 15.120 N DCLK2 n/a
3 TRCN0000315239 TTCCAGATCATCCCGTCATTT pLKO_005 3137 3UTR 100% 13.200 10.560 N DCLK2 n/a
4 TRCN0000315241 AGGAAGTTTCAGAGGATTAAA pLKO_005 1618 CDS 100% 15.000 10.500 N DCLK2 n/a
5 TRCN0000350418 AGTCAAATGCTTCAGGTAAAT pLKO_005 2468 CDS 100% 13.200 9.240 N DCLK2 n/a
6 TRCN0000194863 CAGATCTTCTTCCAATGTAAA pLKO.1 1657 CDS 100% 13.200 9.240 N DCLK2 n/a
7 TRCN0000001974 CCAGGAGAATGTGCAACTTTA pLKO.1 3186 3UTR 100% 13.200 9.240 N DCLK2 n/a
8 TRCN0000315240 GAGATCTCTTTGATGCAATTA pLKO_005 2007 CDS 100% 13.200 9.240 N DCLK2 n/a
9 TRCN0000356202 AGCCAACTTTCTACTCCTAAA pLKO_005 1562 CDS 100% 10.800 7.560 N DCLK2 n/a
10 TRCN0000356265 TGACTTTGTCCTGGATCATAG pLKO_005 1420 CDS 100% 10.800 7.560 N DCLK2 n/a
11 TRCN0000356264 TGGTTCCTGGAGGCATCAAAG pLKO_005 3077 3UTR 100% 10.800 7.560 N DCLK2 n/a
12 TRCN0000024264 CCCAAGTTAGTGACTGTGATT pLKO.1 1169 CDS 100% 4.950 3.465 N Dclk2 n/a
13 TRCN0000001972 TCAGTCAAATGCTTCAGGTAA pLKO.1 2466 CDS 100% 4.950 3.465 N DCLK2 n/a
14 TRCN0000001970 GCAGCCAACTTTCTACTCCTA pLKO.1 1560 CDS 100% 2.640 1.848 N DCLK2 n/a
15 TRCN0000195365 CGATGGAAGAAGCCACTTCTT pLKO.1 3575 3UTR 100% 0.495 0.347 N DCLK2 n/a
16 TRCN0000195602 CCAGAGACAATGCTCAGTATT pLKO.1 3540 3UTR 100% 13.200 7.920 N DCLK2 n/a
17 TRCN0000001973 GCAAATCACCAGCTTCAGTTA pLKO.1 1527 CDS 100% 4.950 2.970 N DCLK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040260.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15276 pDONR223 0% 90.6% 89.9% None (many diffs) n/a
2 ccsbBroad304_15276 pLX_304 0% 90.6% 89.9% V5 (many diffs) n/a
3 ccsbBroadEn_14422 pDONR223 100% 90.5% .5% None (many diffs) n/a
4 ccsbBroad304_14422 pLX_304 0% 90.5% .5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000475901 AACTGCGCTTGTTTCCCTCCGCCA pLX_317 14.8% 90.5% .5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV