Transcript: Human NM_001042370.2

Homo sapiens Ro60, Y RNA binding protein (RO60), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
RO60 (6738)
Length:
2091
CDS:
371..1975

Additional Resources:

NCBI RefSeq record:
NM_001042370.2
NBCI Gene record:
RO60 (6738)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042370.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230349 GCCGCTTACTGCATTACTAAG pLKO_005 1198 CDS 100% 10.800 15.120 N RO60 n/a
2 TRCN0000230350 GGAAATTCAGAAGTATCTTTA pLKO_005 1259 CDS 100% 13.200 10.560 N RO60 n/a
3 TRCN0000159107 GCTCGTATACATCCATTTCAT pLKO.1 1319 CDS 100% 5.625 4.500 N RO60 n/a
4 TRCN0000159417 GCTTCTATGAACCAAAGAGTT pLKO.1 1505 CDS 100% 4.950 3.960 N RO60 n/a
5 TRCN0000230348 GGTCTCACAAAGATCTATTAA pLKO_005 900 CDS 100% 15.000 10.500 N RO60 n/a
6 TRCN0000162033 CTGAGGGAGTATCGAAAGAAA pLKO.1 1817 CDS 100% 5.625 3.938 N RO60 n/a
7 TRCN0000160593 CGTTTCTTACTAGCTGTTGAT pLKO.1 1478 CDS 100% 4.950 3.465 N RO60 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042370.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07000 pDONR223 100% 98.4% 97.9% None (many diffs) n/a
2 ccsbBroad304_07000 pLX_304 0% 98.4% 97.9% V5 (many diffs) n/a
3 TRCN0000465626 CTGGGTGGGATTCAGCACTTATCT pLX_317 23.9% 98.4% 97.9% V5 (many diffs) n/a
Download CSV