Transcript: Human NM_001042493.3

Homo sapiens small integral membrane protein 8 (SMIM8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
SMIM8 (57150)
Length:
2438
CDS:
90..383

Additional Resources:

NCBI RefSeq record:
NM_001042493.3
NBCI Gene record:
SMIM8 (57150)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042493.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412438 ACCAGACAACTGTCGTAAATT pLKO_005 513 3UTR 100% 15.000 21.000 N SMIM8 n/a
2 TRCN0000162705 CTTTCACTTTGCGTGGCATAT pLKO.1 258 CDS 100% 10.800 15.120 N SMIM8 n/a
3 TRCN0000159717 GCTCTTCATTAAACCTAACAA pLKO.1 209 CDS 100% 5.625 7.875 N SMIM8 n/a
4 TRCN0000423731 AGGACCTCTATGAAGCTATTG pLKO_005 313 CDS 100% 10.800 8.640 N SMIM8 n/a
5 TRCN0000161213 GCTTTCGGATTGGTAACTCTT pLKO.1 240 CDS 100% 4.950 3.960 N SMIM8 n/a
6 TRCN0000158968 GCAGCCATTATCTCATTCTTT pLKO.1 550 3UTR 100% 5.625 3.938 N SMIM8 n/a
7 TRCN0000158473 CGTGAAAGTTTACTTGTGTTT pLKO.1 742 3UTR 100% 4.950 3.465 N SMIM8 n/a
8 TRCN0000165548 GCACAGTTATATGAGGCGGAA pLKO.1 344 CDS 100% 2.160 1.512 N SMIM8 n/a
9 TRCN0000158561 CCAAAGAGAAAGAGTTTCAAA pLKO.1 133 CDS 100% 5.625 3.375 N SMIM8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042493.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03796 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03796 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478528 GACATTGCCCATTAGATCCATACG pLX_317 100% 100% 100% V5 n/a
Download CSV