Transcript: Human NM_001042664.1

Homo sapiens pleckstrin homology and RhoGEF domain containing G5 (PLEKHG5), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-23
Taxon:
Homo sapiens (human)
Gene:
PLEKHG5 (57449)
Length:
4715
CDS:
224..3244

Additional Resources:

NCBI RefSeq record:
NM_001042664.1
NBCI Gene record:
PLEKHG5 (57449)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042664.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146515 CCAACCTCCTTACAAGACTTT pLKO.1 2693 CDS 100% 4.950 6.930 N PLEKHG5 n/a
2 TRCN0000434851 TAGGCTGCCCATCCTACTTCT pLKO_005 3520 3UTR 100% 4.950 6.930 N PLEKHG5 n/a
3 TRCN0000430841 TTATCTACCTGAATGAGTTTC pLKO_005 2169 CDS 100% 10.800 8.640 N PLEKHG5 n/a
4 TRCN0000417401 CCGCAAGAACATGTCGGAGTT pLKO_005 829 CDS 100% 4.050 3.240 N PLEKHG5 n/a
5 TRCN0000413932 AGTCCCTGAGTTTGCCGATTC pLKO_005 717 CDS 100% 6.000 4.200 N PLEKHG5 n/a
6 TRCN0000128190 CTGAAACTCTCCAAGAAGAAA pLKO.1 392 CDS 100% 5.625 3.938 N PLEKHG5 n/a
7 TRCN0000146447 CACCATTTACAATGCCCAGAA pLKO.1 2254 CDS 100% 4.050 2.835 N PLEKHG5 n/a
8 TRCN0000147431 GTATTTGAAAGGAAGGGCATT pLKO.1 542 CDS 100% 4.050 2.835 N PLEKHG5 n/a
9 TRCN0000130291 CTTCCTCAAAGGCTTCAAGAT pLKO.1 1483 CDS 100% 4.950 2.970 N PLEKHG5 n/a
10 TRCN0000128350 CACTCTGAAATTTGACCTGAA pLKO.1 454 CDS 100% 4.050 2.430 N PLEKHG5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042664.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12347 pDONR223 100% 92.4% 91.1% None 2733_2932del;2991_3018del n/a
2 ccsbBroad304_12347 pLX_304 0% 92.4% 91.1% V5 2733_2932del;2991_3018del n/a
3 TRCN0000477163 GAGTCTTGACCTGTAGGCAGTGAC pLX_317 12.3% 92.4% 91.1% V5 2733_2932del;2991_3018del n/a
Download CSV