Transcript: Human NM_001045.6

Homo sapiens solute carrier family 6 member 4 (SLC6A4), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SLC6A4 (6532)
Length:
6335
CDS:
306..2198

Additional Resources:

NCBI RefSeq record:
NM_001045.6
NBCI Gene record:
SLC6A4 (6532)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001045.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422925 GGACATTTAAAGAGCGTATTA pLKO_005 2110 CDS 100% 13.200 18.480 N SLC6A4 n/a
2 TRCN0000430015 TGCTATCTCGCTAGCCATATA pLKO_005 2622 3UTR 100% 13.200 18.480 N SLC6A4 n/a
3 TRCN0000042891 GCTCGGTTACATGGCTGAGAT pLKO.1 1451 CDS 100% 4.950 6.930 N SLC6A4 n/a
4 TRCN0000042888 CGGGCAAATATCCAATGGGTA pLKO.1 425 CDS 100% 2.640 3.696 N SLC6A4 n/a
5 TRCN0000423041 CAAGGCCTCCAGCCACTTATT pLKO_005 2352 3UTR 100% 13.200 9.240 N SLC6A4 n/a
6 TRCN0000433497 ACTGTTCATGAATACGTAAAC pLKO_005 2581 3UTR 100% 10.800 7.560 N SLC6A4 n/a
7 TRCN0000042892 CCCTCTGTTTCTCCTGTTCAT pLKO.1 1940 CDS 100% 4.950 3.465 N SLC6A4 n/a
8 TRCN0000042889 CTGGAGTATCATCTTGGGTTA pLKO.1 2021 CDS 100% 4.050 2.835 N SLC6A4 n/a
9 TRCN0000042890 GCGTGTGAAGATGGAGAAGAT pLKO.1 345 CDS 100% 4.950 2.970 N SLC6A4 n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4556 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4556 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000136382 CACCTGTAATTCCAGCACTTT pLKO.1 5113 3UTR 100% 4.950 2.475 Y CENPL n/a
13 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 5152 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 5152 3UTR 100% 4.050 2.025 Y ORAI2 n/a
15 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 5152 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4723 3UTR 100% 10.800 5.400 Y SMIM11A n/a
17 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4554 3UTR 100% 4.950 2.475 Y ERN2 n/a
18 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4554 3UTR 100% 4.950 2.475 Y P3H4 n/a
19 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4554 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001045.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.