Transcript: Human NM_001060.6

Homo sapiens thromboxane A2 receptor (TBXA2R), transcript variant a, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
TBXA2R (6915)
Length:
2642
CDS:
430..1461

Additional Resources:

NCBI RefSeq record:
NM_001060.6
NBCI Gene record:
TBXA2R (6915)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001060.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378531 ATGGGCGTCGTCATGATCTTC pLKO_005 751 CDS 100% 4.950 6.930 N TBXA2R n/a
2 TRCN0000014176 GCCCACAAACATTACCCTGGA pLKO.1 468 CDS 100% 2.160 3.024 N TBXA2R n/a
3 TRCN0000363182 GAGGGTCTTGCATTGCTATTT pLKO_005 1743 3UTR 100% 13.200 10.560 N TBXA2R n/a
4 TRCN0000358228 AGAAGGAGCTGCTCATCTACT pLKO_005 1289 CDS 100% 4.950 3.465 N TBXA2R n/a
5 TRCN0000358157 CTGCCTGTTCTGAGGATTCAG pLKO_005 1525 3UTR 100% 4.950 3.465 N TBXA2R n/a
6 TRCN0000363185 GGGTCGCTACACCGTGCAATA pLKO_005 942 CDS 100% 3.600 2.520 N TBXA2R n/a
7 TRCN0000014175 CTGCCGTCTCTGTCGCTTCAT pLKO.1 732 CDS 100% 1.650 1.155 N TBXA2R n/a
8 TRCN0000014177 GCTGCTCATCTACTTGCGCGT pLKO.1 1296 CDS 100% 0.180 0.126 N TBXA2R n/a
9 TRCN0000014173 CCTCCCGCGCCTTTCCGCGGA pLKO.1 1479 3UTR 100% 0.000 0.000 N TBXA2R n/a
10 TRCN0000014174 CGCCCAGACAGTGCTGCGAAA pLKO.1 1224 CDS 100% 0.000 0.000 N TBXA2R n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001060.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488304 AATATGACGAGACCCGATGATGTT pLX_317 24.4% 99.8% 99.7% V5 924T>C;1029_1030insG n/a
2 TRCN0000489519 ATCTTAACGATATAAAGTCATCGA pLX_317 38.3% 99.9% 100% V5 (not translated due to prior stop codon) 924T>C n/a
3 ccsbBroadEn_11174 pDONR223 100% 54.8% 39.1% None 397_785del;795C>T;1029_1030ins137 n/a
4 ccsbBroad304_11174 pLX_304 0% 54.8% 39.1% V5 397_785del;795C>T;1029_1030ins137 n/a
5 TRCN0000475653 ATCTGCATCGACCGGTCCGATTTT pLX_317 28.8% 54.8% 39.1% V5 397_785del;795C>T;1029_1030ins137 n/a
Download CSV