Transcript: Mouse NM_001077190.3

Mus musculus abl-interactor 1 (Abi1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Abi1 (11308)
Length:
3428
CDS:
177..1622

Additional Resources:

NCBI RefSeq record:
NM_001077190.3
NBCI Gene record:
Abi1 (11308)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001077190.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018497 TGTTGAATCAATCATGCACTA pLKO.1 1592 CDS 100% 4.050 5.670 N Abi1 n/a
2 TRCN0000018849 CGAGGGACTTTGGGACGGAAT pLKO.1 741 CDS 100% 1.350 1.890 N Abi1 n/a
3 TRCN0000321711 CGAGGGACTTTGGGACGGAAT pLKO_005 741 CDS 100% 1.350 1.890 N Abi1 n/a
4 TRCN0000018496 CGACATCTTCTGGTGGATATA pLKO.1 1075 CDS 100% 13.200 9.240 N Abi1 n/a
5 TRCN0000321712 CGACATCTTCTGGTGGATATA pLKO_005 1075 CDS 100% 13.200 9.240 N Abi1 n/a
6 TRCN0000350748 TCCAATTTGTGTAACGATTAT pLKO_005 2101 3UTR 100% 13.200 9.240 N Abi1 n/a
7 TRCN0000018495 GCTCGAAGAGAGATTGGTATT pLKO.1 489 CDS 100% 10.800 7.560 N Abi1 n/a
8 TRCN0000321647 GCTCGAAGAGAGATTGGTATT pLKO_005 489 CDS 100% 10.800 7.560 N Abi1 n/a
9 TRCN0000018494 CCTGTCAGGTATATTCGGAAA pLKO.1 573 CDS 100% 4.050 2.835 N Abi1 n/a
10 TRCN0000321710 CCTGTCAGGTATATTCGGAAA pLKO_005 573 CDS 100% 4.050 2.835 N Abi1 n/a
11 TRCN0000157985 CCTCAGTTGACTCCACAGATA pLKO.1 1203 CDS 100% 4.950 3.465 N ABI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077190.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14034 pDONR223 100% 91.3% 96.6% None (many diffs) n/a
2 ccsbBroad304_14034 pLX_304 0% 91.3% 96.6% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000481323 TCTTTGTGCACTTCCTTGTCAAAT pLX_317 29.3% 91.3% 96.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV