Transcript: Human NM_001077198.3

Homo sapiens autophagy related 9A (ATG9A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
ATG9A (79065)
Length:
3770
CDS:
184..2703

Additional Resources:

NCBI RefSeq record:
NM_001077198.3
NBCI Gene record:
ATG9A (79065)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148385 CTTTACGTCTATCCAGTCCTT pLKO.1 1995 CDS 100% 2.640 3.696 N ATG9A n/a
2 TRCN0000244084 AGCCTGCATGCCCTCTATATG pLKO_005 2302 CDS 100% 13.200 10.560 N ATG9A n/a
3 TRCN0000244081 AGTCACCTTGGCACCATATTG pLKO_005 284 CDS 100% 13.200 9.240 N ATG9A n/a
4 TRCN0000244080 GACCGTGTGCAGGTCCTTTAT pLKO_005 1437 CDS 100% 13.200 9.240 N ATG9A n/a
5 TRCN0000244082 GTGGACTATGACATCCTATTT pLKO_005 442 CDS 100% 13.200 9.240 N ATG9A n/a
6 TRCN0000148400 CGTCTATCCAGTCCTTACAAT pLKO.1 2000 CDS 100% 5.625 3.938 N ATG9A n/a
7 TRCN0000129286 CTTCCAGTACAAGGCAGTGTT pLKO.1 1587 CDS 100% 4.950 3.465 N ATG9A n/a
8 TRCN0000244083 TGTAGGAGCAGGATGGAAATA pLKO_005 3367 3UTR 100% 13.200 7.920 N ATG9A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000471062 AGCTATAACGCCGGTCCCCTTAAC pLX_317 24.3% 62.6% 52.9% V5 (many diffs) n/a
2 ccsbBroadEn_12539 pDONR223 100% 62% 60.1% None 1_288del;1781delC;1853_2517del n/a
3 ccsbBroad304_12539 pLX_304 0% 62% 60.1% V5 1_288del;1781delC;1853_2517del n/a
4 TRCN0000481101 AGGGAACGCGCGGTGGCAGAGAAC pLX_317 25% 62% 60.1% V5 1_288del;1781delC;1853_2517del n/a
Download CSV