Transcript: Mouse NM_001077359.1

Mus musculus G protein-coupled receptor kinase-interactor 2 (Git2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Git2 (26431)
Length:
4944
CDS:
128..2170

Additional Resources:

NCBI RefSeq record:
NM_001077359.1
NBCI Gene record:
Git2 (26431)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001077359.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349884 GGCCGGAAACCAGATCATAAA pLKO_005 833 CDS 100% 13.200 18.480 N Git2 n/a
2 TRCN0000313296 TCAATCTCTGAGTAATCATTT pLKO_005 940 CDS 100% 13.200 18.480 N Git2 n/a
3 TRCN0000088573 CCACGGTCTTTACTTGCCAAA pLKO.1 4563 3UTR 100% 4.050 5.670 N Git2 n/a
4 TRCN0000088577 GAGAGGATACACGTTGCTGTA pLKO.1 1910 CDS 100% 4.050 5.670 N Git2 n/a
5 TRCN0000313358 CCCATGCCTAAAGCTATAATT pLKO_005 2453 3UTR 100% 15.000 10.500 N Git2 n/a
6 TRCN0000313297 ACAATGGTGCTAACTCTATAT pLKO_005 333 CDS 100% 13.200 9.240 N Git2 n/a
7 TRCN0000088575 GACAGAAATTAGCTCGGTTTA pLKO.1 1122 CDS 100% 10.800 7.560 N Git2 n/a
8 TRCN0000312276 GACAGAAATTAGCTCGGTTTA pLKO_005 1122 CDS 100% 10.800 7.560 N Git2 n/a
9 TRCN0000088576 AGACAGAAATTAGCTCGGTTT pLKO.1 1121 CDS 100% 4.050 2.835 N Git2 n/a
10 TRCN0000088574 CCTGTTGACTATGCAAGGCAA pLKO.1 734 CDS 100% 2.640 1.848 N Git2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077359.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11418 pDONR223 100% 68.9% 70.5% None (many diffs) n/a
2 ccsbBroad304_11418 pLX_304 0% 68.9% 70.5% V5 (many diffs) n/a
3 TRCN0000465676 TGCATATTGTGGGCGCGACGGAGA pLX_317 22% 68.9% 70.5% V5 (many diffs) n/a
Download CSV