Transcript: Human NM_001077527.3

Homo sapiens Jrk helix-turn-helix protein (JRK), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
JRK (8629)
Length:
3564
CDS:
499..2169

Additional Resources:

NCBI RefSeq record:
NM_001077527.3
NBCI Gene record:
JRK (8629)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077527.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219822 TCCGATTGGTTCCATCATATC pLKO.1 1300 CDS 100% 10.800 15.120 N JRK n/a
2 TRCN0000219821 AGGGTGGCTTTGGCGCTTTAA pLKO.1 897 CDS 100% 13.200 9.240 N JRK n/a
3 TRCN0000148274 CAACATGAACGATGCCATATT pLKO.1 1569 CDS 100% 13.200 9.240 N JRK n/a
4 TRCN0000436407 CACTTCAGAACCATAGGTTTG pLKO_005 1342 CDS 100% 6.000 4.200 N JRK n/a
5 TRCN0000180241 CCACAACAAGTCCTTTGCACA pLKO.1 1728 CDS 100% 2.640 1.848 N JRK n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2525 3UTR 100% 4.950 2.475 Y ERAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077527.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07276 pDONR223 100% 95.1% 92% None (many diffs) n/a
2 ccsbBroad304_07276 pLX_304 0% 95.1% 92% V5 (many diffs) n/a
3 TRCN0000481293 TCATCTAACCTCTCCGACCAATTT pLX_317 24.7% 95.1% 92% V5 (many diffs) n/a
Download CSV