Transcript: Human NM_001079537.2

Homo sapiens trafficking protein particle complex 6B (TRAPPC6B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
TRAPPC6B (122553)
Length:
3251
CDS:
239..715

Additional Resources:

NCBI RefSeq record:
NM_001079537.2
NBCI Gene record:
TRAPPC6B (122553)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001079537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146857 CGATGTATTACTAAGCTGGAA pLKO.1 329 CDS 100% 2.640 3.696 N TRAPPC6B n/a
2 TRCN0000433572 CAAGATGCAGGGCCCTTATTT pLKO_005 941 3UTR 100% 15.000 12.000 N TRAPPC6B n/a
3 TRCN0000129851 CGACAATCTAAGGACAAATCA pLKO.1 481 CDS 100% 5.625 4.500 N TRAPPC6B n/a
4 TRCN0000425677 CAACAGTGTAAAGAGATAAAT pLKO_005 738 3UTR 100% 15.000 10.500 N TRAPPC6B n/a
5 TRCN0000435173 CTTATCAAACTTGGGAATAAA pLKO_005 625 CDS 100% 15.000 10.500 N TRAPPC6B n/a
6 TRCN0000130744 GCAAGGCTTCAACAGTGTAAA pLKO.1 729 3UTR 100% 13.200 9.240 N TRAPPC6B n/a
7 TRCN0000435222 GCATTTACGTGTGGCTTAATC pLKO_005 596 CDS 100% 13.200 9.240 N TRAPPC6B n/a
8 TRCN0000423274 TCAATTTAACACAGATCAAAG pLKO_005 839 3UTR 100% 10.800 7.560 N TRAPPC6B n/a
9 TRCN0000130908 GCAAGGTTCAAGGATGAGTTA pLKO.1 404 CDS 100% 4.950 3.465 N TRAPPC6B n/a
10 TRCN0000201704 GATACTGCAAGGTTCAAGGAT pLKO.1 398 CDS 100% 3.000 2.100 N Trappc6b n/a
11 TRCN0000129841 CAAATCGACAATCTAAGGACA pLKO.1 476 CDS 100% 2.640 1.848 N TRAPPC6B n/a
12 TRCN0000149211 GTGGCTTATCAAACTTGGGAA pLKO.1 621 CDS 100% 2.640 1.848 N TRAPPC6B n/a
13 TRCN0000147975 GCCATAGAAATGGCAGATTAA pLKO.1 1799 3UTR 100% 1.320 0.924 N TRAPPC6B n/a
14 TRCN0000146801 CCAATCATGGTAATTGGCTTA pLKO.1 2707 3UTR 100% 0.405 0.284 N TRAPPC6B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001079537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04763 pDONR223 100% 82.2% 82.2% None 266_349del n/a
2 ccsbBroad304_04763 pLX_304 0% 82.2% 82.2% V5 266_349del n/a
3 TRCN0000480213 CGCTTCAGCCCCCTCAGAATTATC pLX_317 100% 82.2% 82.2% V5 266_349del n/a
Download CSV