Transcript: Human NM_001079539.1

Homo sapiens X-box binding protein 1 (XBP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
XBP1 (7494)
Length:
1810
CDS:
49..1179

Additional Resources:

NCBI RefSeq record:
NM_001079539.1
NBCI Gene record:
XBP1 (7494)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001079539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019808 AGATCGAAAGAAGGCTCGAAT pLKO.1 312 CDS 100% 4.950 6.930 N XBP1 n/a
2 TRCN0000277989 AGATCGAAAGAAGGCTCGAAT pLKO_005 312 CDS 100% 4.950 6.930 N XBP1 n/a
3 TRCN0000019805 GCGGTATTGACTCTTCAGATT pLKO.1 596 CDS 100% 4.950 6.930 N XBP1 n/a
4 TRCN0000277988 GCGGTATTGACTCTTCAGATT pLKO_005 596 CDS 100% 4.950 6.930 N XBP1 n/a
5 TRCN0000019806 GAACAGCAAGTGGTAGATTTA pLKO.1 343 CDS 100% 13.200 9.240 N XBP1 n/a
6 TRCN0000277990 GAACAGCAAGTGGTAGATTTA pLKO_005 343 CDS 100% 13.200 9.240 N XBP1 n/a
7 TRCN0000019807 GACCCAGTCATGTTCTTCAAA pLKO.1 655 CDS 100% 5.625 3.938 N XBP1 n/a
8 TRCN0000278050 GACCCAGTCATGTTCTTCAAA pLKO_005 655 CDS 100% 5.625 3.938 N XBP1 n/a
9 TRCN0000019804 GCCTGTCTGTACTTCATTCAA pLKO.1 1243 3UTR 100% 5.625 3.938 N XBP1 n/a
10 TRCN0000278051 GCCTGTCTGTACTTCATTCAA pLKO_005 1243 3UTR 100% 5.625 3.938 N XBP1 n/a
11 TRCN0000008419 CCCAGCTGATTAGTGTCTAAA pLKO.1 1160 CDS 100% 13.200 10.560 N Xbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001079539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13982 pDONR223 97.1% 65.5% 41.5% None 10G>A;492_493ins26;758_1128del n/a
2 ccsbBroad304_13982 pLX_304 0% 65.5% 41.5% V5 10G>A;492_493ins26;758_1128del n/a
3 TRCN0000467935 GACGACACCCCTTCCACCAATGGT pLX_317 51.8% 65.5% 41.5% V5 10G>A;492_493ins26;758_1128del n/a
Download CSV