Transcript: Mouse NM_001079690.1

Mus musculus solute carrier family 12, member 1 (Slc12a1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Slc12a1 (20495)
Length:
4660
CDS:
233..3520

Additional Resources:

NCBI RefSeq record:
NM_001079690.1
NBCI Gene record:
Slc12a1 (20495)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001079690.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070016 CCCACGCCTTTACGAAGAATA pLKO.1 2322 CDS 100% 13.200 18.480 N Slc12a1 n/a
2 TRCN0000070013 CCTCTATATCTATGTGACTTA pLKO.1 2131 CDS 100% 4.950 3.465 N Slc12a1 n/a
3 TRCN0000070015 CCGTGGTGATTCTTCTAGGAA pLKO.1 1143 CDS 100% 3.000 2.100 N Slc12a1 n/a
4 TRCN0000070014 CCATCGTTTCTGGGATGAATT pLKO.1 1563 CDS 100% 0.000 0.000 N Slc12a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001079690.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11139 pDONR223 100% 32.7% 33.2% None (many diffs) n/a
2 ccsbBroad304_11139 pLX_304 0% 32.7% 33.2% V5 (many diffs) n/a
3 TRCN0000466651 GTAGTATTTCTTAAATAGCTGGAA pLX_317 34.1% 32.7% 33.2% V5 (many diffs) n/a
Download CSV