Transcript: Mouse NM_001079814.1

Mus musculus glyoxylate reductase 1 homolog (Arabidopsis) (Glyr1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Glyr1 (74022)
Length:
3365
CDS:
68..1726

Additional Resources:

NCBI RefSeq record:
NM_001079814.1
NBCI Gene record:
Glyr1 (74022)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001079814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241373 ATGACAAGAATCGGCGTAATT pLKO_005 384 CDS 100% 13.200 18.480 N Glyr1 n/a
2 TRCN0000191376 CGGTTAGTCAATGTTGTCTTA pLKO.1 3002 3UTR 100% 4.950 6.930 N Glyr1 n/a
3 TRCN0000241374 TGGACCGATGGCTGCATTTAA pLKO_005 646 CDS 100% 15.000 12.000 N Glyr1 n/a
4 TRCN0000241372 AGCCTGATCAACACCAATAAT pLKO_005 2613 3UTR 100% 15.000 10.500 N Glyr1 n/a
5 TRCN0000241376 AGAGGCTCCAAATGCCTTAAA pLKO_005 527 CDS 100% 13.200 9.240 N Glyr1 n/a
6 TRCN0000217884 GGACCAGTCTGACAATGATAT pLKO.1 1675 CDS 100% 13.200 9.240 N Glyr1 n/a
7 TRCN0000241375 TAAAGATTAACAAGGGTAAAC pLKO_005 279 CDS 100% 10.800 7.560 N Glyr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001079814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12837 pDONR223 100% 81% 86% None (many diffs) n/a
2 ccsbBroad304_12837 pLX_304 0% 81% 86% V5 (many diffs) n/a
3 TRCN0000478521 CACCAGGACAGGTCCAATTAGTTT pLX_317 26.5% 81% 86% V5 (many diffs) n/a
Download CSV