Transcript: Mouse NM_001080754.1

Mus musculus autophagy/beclin 1 regulator 1 (Ambra1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ambra1 (228361)
Length:
5056
CDS:
362..3991

Additional Resources:

NCBI RefSeq record:
NM_001080754.1
NBCI Gene record:
Ambra1 (228361)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001080754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429045 ATGCTCTACACCAAGCGATTT pLKO_005 2891 CDS 100% 10.800 15.120 N AMBRA1 n/a
2 TRCN0000189704 GCATTCGCCATGAGCTTCAAT pLKO.1 1572 CDS 100% 5.625 7.875 N Ambra1 n/a
3 TRCN0000190777 GCACTGCAATGTGACCAATAA pLKO.1 3895 CDS 100% 13.200 10.560 N Ambra1 n/a
4 TRCN0000189905 GCCACTGGGAACGCATTTATA pLKO.1 2055 CDS 100% 15.000 10.500 N Ambra1 n/a
5 TRCN0000189940 GCACCTTCACTTGGACGATTT pLKO.1 2483 CDS 100% 10.800 7.560 N Ambra1 n/a
6 TRCN0000168355 GAGATTATCTCCTGCTGCATA pLKO.1 2248 CDS 100% 4.950 3.465 N AMBRA1 n/a
7 TRCN0000167238 CCTCATTTCATTATCCCGTTA pLKO.1 2182 CDS 100% 4.050 2.835 N AMBRA1 n/a
8 TRCN0000425163 GTGACCTGAGACGCTTCTTTC pLKO_005 1593 CDS 100% 10.800 7.560 N AMBRA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08557 pDONR223 100% 91.5% 95.6% None (many diffs) n/a
2 ccsbBroad304_08557 pLX_304 0% 91.5% 95.6% V5 (many diffs) n/a
3 TRCN0000481129 TCCAACTATCCCTTACAAGCGGAA pLX_317 10.5% 91.5% 95.6% V5 (many diffs) n/a
Download CSV