Transcript: Mouse NM_001080755.2

Mus musculus zinc finger, ZZ domain containing 3 (Zzz3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Zzz3 (108946)
Length:
7607
CDS:
447..3179

Additional Resources:

NCBI RefSeq record:
NM_001080755.2
NBCI Gene record:
Zzz3 (108946)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001080755.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336316 TACCTGTGGAACGACGAAATC pLKO_005 1327 CDS 100% 0.000 0.000 N Zzz3 n/a
2 TRCN0000336254 TTGTAGGTGGTGGTGTTAAAT pLKO_005 3392 3UTR 100% 15.000 10.500 N Zzz3 n/a
3 TRCN0000194364 CAGGCAGAACACCTAACTTAT pLKO.1 2608 CDS 100% 13.200 9.240 N Zzz3 n/a
4 TRCN0000353323 CAGGCAGAACACCTAACTTAT pLKO_005 2608 CDS 100% 13.200 9.240 N Zzz3 n/a
5 TRCN0000336315 TTCCCGATCTACTCGTGTTAC pLKO_005 476 CDS 100% 10.800 7.560 N Zzz3 n/a
6 TRCN0000370301 TTCCCGATCTACTCGTGTTAC pLKO_005 476 CDS 100% 10.800 7.560 N ZZZ3 n/a
7 TRCN0000193117 CCAGAGTGAATATTGGACATT pLKO.1 1843 CDS 100% 4.950 3.465 N Zzz3 n/a
8 TRCN0000176316 CCTATTGGATTTGTGGAGAAA pLKO.1 2079 CDS 100% 4.950 3.465 N Zzz3 n/a
9 TRCN0000193719 CCTCTTTAAACCTTCCACTTT pLKO.1 2684 CDS 100% 4.950 3.465 N Zzz3 n/a
10 TRCN0000353324 AGTGAGGAAGGGCCACTTAAT pLKO_005 1014 CDS 100% 13.200 7.920 N Zzz3 n/a
11 TRCN0000376637 AGTGAGGAAGGGCCACTTAAT pLKO_005 1014 CDS 100% 13.200 7.920 N ZZZ3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080755.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14102 pDONR223 100% 39.9% 41.3% None (many diffs) n/a
2 ccsbBroad304_14102 pLX_304 0% 39.9% 41.3% V5 (many diffs) n/a
3 TRCN0000467796 CCCCAAGCTGACCCAAAACTTGAA pLX_317 32.1% 39.9% 41.3% V5 (many diffs) n/a
Download CSV