Transcript: Human NM_001080821.3

Homo sapiens zinc finger protein 799 (ZNF799), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
ZNF799 (90576)
Length:
2583
CDS:
202..2133

Additional Resources:

NCBI RefSeq record:
NM_001080821.3
NBCI Gene record:
ZNF799 (90576)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080821.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437018 CACGAGAGATGGACCTCATAA pLKO_005 1194 CDS 100% 13.200 9.240 N ZNF799 n/a
2 TRCN0000416889 CCAATACCTTTCTCAACATAG pLKO_005 1665 CDS 100% 10.800 6.480 N ZNF799 n/a
3 TRCN0000219000 ACTGCAGAGAAACCCTATAAA pLKO_005 1447 CDS 100% 15.000 7.500 Y ZNF443 n/a
4 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1531 CDS 100% 15.000 7.500 Y ZNF443 n/a
5 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1531 CDS 100% 15.000 7.500 Y Zfp97 n/a
6 TRCN0000444979 GCGTGGAGATGGACCTTATAA pLKO_005 774 CDS 100% 15.000 7.500 Y ZNF799 n/a
7 TRCN0000218137 CAGTTCCTTGCATAGACATAA pLKO_005 2001 CDS 100% 13.200 6.600 Y ZNF443 n/a
8 TRCN0000018222 CCAGAACATTGAAGATCAATA pLKO.1 348 CDS 100% 13.200 6.600 Y ZNF443 n/a
9 TRCN0000018221 CCTATCTAAGACATGAAAGAA pLKO.1 917 CDS 100% 5.625 2.813 Y ZNF443 n/a
10 TRCN0000015692 CCTTTGTTTATCCCAGTGTAT pLKO.1 1403 CDS 100% 4.950 2.475 Y ZNF563 n/a
11 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 1798 CDS 100% 4.050 2.025 Y ZNF700 n/a
12 TRCN0000107954 GATGCAGGAAACCATCAGGAA pLKO.1 297 CDS 100% 2.640 1.320 Y ZNF799 n/a
13 TRCN0000230529 ACTGGAAAGAAACCCTATAAA pLKO_005 1027 CDS 100% 15.000 7.500 Y ZNF99 n/a
14 TRCN0000239754 GAGAAACCTTATGAGTGTAAT pLKO_005 1702 CDS 100% 13.200 6.600 Y Gm11677 n/a
15 TRCN0000423291 ACTGGAAAGAAACCCTATAAG pLKO_005 1027 CDS 100% 13.200 6.600 Y Zfp677 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080821.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05002 pDONR223 100% 62.1% 54.8% None (many diffs) n/a
2 ccsbBroad304_05002 pLX_304 0% 62.1% 54.8% V5 (many diffs) n/a
3 TRCN0000481100 ACGCTTAGGCTAATGTCCTTGTGC pLX_317 27.2% 62.1% 54.8% V5 (many diffs) n/a
Download CSV