Transcript: Human NM_001080825.2

Homo sapiens transmembrane protein 120B (TMEM120B), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
TMEM120B (144404)
Length:
7510
CDS:
145..1164

Additional Resources:

NCBI RefSeq record:
NM_001080825.2
NBCI Gene record:
TMEM120B (144404)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080825.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253822 AGCAACGGCTCAAGAATTAAA pLKO_005 682 CDS 100% 15.000 10.500 N TMEM120B n/a
2 TRCN0000253825 GCCACGTGGTGAGGGTTATTT pLKO_005 1658 3UTR 100% 15.000 10.500 N TMEM120B n/a
3 TRCN0000253826 GCGTCCAGTTCCTGCAATATT pLKO_005 827 CDS 100% 15.000 10.500 N TMEM120B n/a
4 TRCN0000253824 ACAATGCCGTCACGCTGTTTG pLKO_005 995 CDS 100% 10.800 7.560 N TMEM120B n/a
5 TRCN0000253823 CTGGCCTAATGGACCCATTTA pLKO_005 759 CDS 100% 13.200 7.920 N TMEM120B n/a
6 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3708 3UTR 100% 4.950 2.475 Y ORAI2 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3632 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2598 3UTR 100% 4.950 2.475 Y n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3633 3UTR 100% 13.200 6.600 Y LIAS n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2669 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3705 3UTR 100% 4.950 2.475 Y LOC339059 n/a
12 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 2490 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2669 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080825.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04972 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04972 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475722 TTGTGTATCCTCCCTATATCATTT pLX_317 34% 100% 100% V5 n/a
Download CSV