Transcript: Mouse NM_001080927.2

Mus musculus recombination signal binding protein for immunoglobulin kappa J region (Rbpj), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Rbpj (19664)
Length:
5508
CDS:
220..1683

Additional Resources:

NCBI RefSeq record:
NM_001080927.2
NBCI Gene record:
Rbpj (19664)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001080927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097287 CCCTGTGCGTTTATTGGAATA pLKO.1 475 CDS 100% 10.800 15.120 N Rbpj n/a
2 TRCN0000324658 CCCTGTGCGTTTATTGGAATA pLKO_005 475 CDS 100% 10.800 15.120 N Rbpj n/a
3 TRCN0000305837 TAGGGAAGCTATGCGAAATTA pLKO_005 276 CDS 100% 15.000 10.500 N Rbpj n/a
4 TRCN0000097288 CTGTATCACAACTCCACAAAT pLKO.1 1016 CDS 100% 13.200 9.240 N Rbpj n/a
5 TRCN0000097286 CCAGTGACTTTGGTCCGAAAT pLKO.1 1453 CDS 100% 10.800 7.560 N Rbpj n/a
6 TRCN0000324657 CCAGTGACTTTGGTCCGAAAT pLKO_005 1453 CDS 100% 10.800 7.560 N Rbpj n/a
7 TRCN0000097284 GCAGACTCATTGGGCTACATT pLKO.1 3174 3UTR 100% 5.625 3.938 N Rbpj n/a
8 TRCN0000353944 GCAGACTCATTGGGCTACATT pLKO_005 3174 3UTR 100% 5.625 3.938 N Rbpj n/a
9 TRCN0000097285 CCAGACAGTTAGTACCAGGTA pLKO.1 765 CDS 100% 2.640 1.848 N Rbpj n/a
10 TRCN0000324721 CCAGACAGTTAGTACCAGGTA pLKO_005 765 CDS 100% 2.640 1.848 N Rbpj n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06435 pDONR223 100% 90% 97.3% None (many diffs) n/a
2 ccsbBroad304_06435 pLX_304 38.7% 90% 97.3% V5 (many diffs) n/a
3 TRCN0000470066 CCAATAGATCCTTCAAGCAGAACC pLX_317 29.2% 90% 97.3% V5 (many diffs) n/a
Download CSV