Transcript: Mouse NM_001081236.1

Mus musculus RIKEN cDNA 2410131K14 gene (2410131K14Rik), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
2410131K14Rik (76792)
Length:
2670
CDS:
122..739

Additional Resources:

NCBI RefSeq record:
NM_001081236.1
NBCI Gene record:
2410131K14Rik (76792)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081236.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268974 TTTCGGCCTCTCGCTAGTTTA pLKO_005 187 CDS 100% 13.200 18.480 N 2410131K14Rik n/a
2 TRCN0000268921 TCGAACTGTGCTTGGCTAAAT pLKO_005 618 CDS 100% 13.200 10.560 N 2410131K14Rik n/a
3 TRCN0000268923 TGCAGTTTAACCTAGGCAACA pLKO_005 303 CDS 100% 4.050 3.240 N 2410131K14Rik n/a
4 TRCN0000268922 CCAGTGGCATTGGTCATATTT pLKO_005 2269 3UTR 100% 15.000 10.500 N 2410131K14Rik n/a
5 TRCN0000283856 ACTGATGAGCTGGGCTATGTC pLKO_005 377 CDS 100% 4.950 3.465 N 2410131K14Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081236.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04127 pDONR223 100% 85.7% 92.6% None (many diffs) n/a
2 ccsbBroad304_04127 pLX_304 0% 85.7% 92.6% V5 (many diffs) n/a
3 TRCN0000473525 TGCCTCACACACTTATAGATCAGG pLX_317 76.2% 85.7% 92.6% V5 (many diffs) n/a
Download CSV