Transcript: Mouse NM_001081421.1

Mus musculus UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16 (Galnt16), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Galnt16 (108760)
Length:
3920
CDS:
180..1856

Additional Resources:

NCBI RefSeq record:
NM_001081421.1
NBCI Gene record:
Galnt16 (108760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251575 GGACGAGTACAAACAGTATTA pLKO_005 1304 CDS 100% 13.200 18.480 N Galnt16 n/a
2 TRCN0000251574 TGGGCACTTTCTACTACTTAT pLKO_005 232 CDS 100% 13.200 18.480 N Galnt16 n/a
3 TRCN0000251577 GGGCAATGCCCTCACCTATAT pLKO_005 1250 CDS 100% 13.200 10.560 N Galnt16 n/a
4 TRCN0000251576 CCAGCCCAGGCATGGTTATTT pLKO_005 1584 CDS 100% 15.000 10.500 N Galnt16 n/a
5 TRCN0000251573 TACACCCTGAAATACCCTTAT pLKO_005 2656 3UTR 100% 10.800 7.560 N Galnt16 n/a
6 TRCN0000034929 CCTGGGCACTTTCTACTACTT pLKO.1 230 CDS 100% 4.950 3.465 N GALNT16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03820 pDONR223 100% 90.2% 96% None (many diffs) n/a
2 ccsbBroad304_03820 pLX_304 0% 90.2% 96% V5 (many diffs) n/a
3 TRCN0000472542 TGTCCACTACAGTGACAAGGTTTC pLX_317 30.6% 90.2% 96% V5 (many diffs) n/a
Download CSV