Transcript: Human NM_001081491.2

Homo sapiens nuclear RNA export factor 1 (NXF1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
NXF1 (10482)
Length:
4091
CDS:
85..1155

Additional Resources:

NCBI RefSeq record:
NM_001081491.2
NBCI Gene record:
NXF1 (10482)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001081491.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435088 ACGATGATGAACGCGTTAATT pLKO_005 116 CDS 100% 15.000 21.000 N NXF1 n/a
2 TRCN0000011092 CGCGAACGATTTCCCAAGTTA pLKO.1 2909 3UTR 100% 5.625 7.875 N NXF1 n/a
3 TRCN0000007580 CCCTGTAAATAGTCCTTGGAT pLKO.1 3773 3UTR 100% 3.000 4.200 N NXF1 n/a
4 TRCN0000420330 CATTGAAGGCTGTCAACTATA pLKO_005 596 CDS 100% 13.200 9.240 N NXF1 n/a
5 TRCN0000421912 GAAGCAGCTTAGCCGAGTATT pLKO_005 3171 3UTR 100% 13.200 9.240 N NXF1 n/a
6 TRCN0000007583 GCGGGAATTGGACAAGATAAA pLKO.1 1002 CDS 100% 13.200 9.240 N NXF1 n/a
7 TRCN0000007581 CCAGTTCTGAAGAGATCCAAA pLKO.1 3501 3UTR 100% 4.950 3.465 N NXF1 n/a
8 TRCN0000007582 CCGAAGGATATCTATCATCAT pLKO.1 636 CDS 100% 4.950 3.465 N NXF1 n/a
9 TRCN0000413368 TCAGAAGATTGAGCCTCACTG pLKO_005 3911 3UTR 100% 4.050 2.835 N NXF1 n/a
10 TRCN0000436264 CAACAGTACTATGCAATTTAC pLKO_005 3059 3UTR 100% 13.200 7.920 N NXF1 n/a
11 TRCN0000102267 GCGAACGATTTCCCAAGTTAT pLKO.1 2910 3UTR 100% 13.200 18.480 N Nxf1 n/a
12 TRCN0000287244 GCGAACGATTTCCCAAGTTAT pLKO_005 2910 3UTR 100% 13.200 18.480 N Nxf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081491.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02452 pDONR223 100% 56.6% 55.5% None (many diffs) n/a
2 ccsbBroad304_02452 pLX_304 0% 56.6% 55.5% V5 (many diffs) n/a
3 TRCN0000469046 CCACTGTAACTGATTCTGACATGC pLX_317 23.1% 56.6% 55.5% V5 (many diffs) n/a
Download CSV