Transcript: Mouse NM_001082961.2

Mus musculus small nuclear ribonucleoprotein N (Snrpn), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Snrpn (20646)
Length:
2066
CDS:
578..1300

Additional Resources:

NCBI RefSeq record:
NM_001082961.2
NBCI Gene record:
Snrpn (20646)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001082961.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414348 AGACACCAAGAGGTGGTTAAA pLKO_005 372 5UTR 100% 13.200 6.600 Y SNURF n/a
2 TRCN0000430814 TGCTGCAGCACATTGACTATA pLKO_005 603 CDS 100% 13.200 6.600 Y SNRPN n/a
3 TRCN0000431217 TTAGTGTTGACAACGGCTATT pLKO_005 543 5UTR 100% 10.800 5.400 Y Snurf n/a
4 TRCN0000109286 CAGGAAGATCAAGCCAAAGAA pLKO.1 721 CDS 100% 5.625 2.813 Y Snrpn n/a
5 TRCN0000111933 CAACCAAGAGTGTCACTTGTA pLKO.1 277 5UTR 100% 4.950 2.475 Y Snurf n/a
6 TRCN0000075134 CCTCTGTGATTGTGATGAGTT pLKO.1 700 CDS 100% 4.950 2.475 Y SNRPN n/a
7 TRCN0000111931 CGTTCTCAGCAACAGCAAGTT pLKO.1 305 5UTR 100% 4.950 2.475 Y Snurf n/a
8 TRCN0000111930 GCAACTTCAAGGTGGTGGAAT pLKO.1 401 5UTR 100% 4.950 2.475 Y Snurf n/a
9 TRCN0000111934 TGAGACACCAAGAGGTGGTTA pLKO.1 370 5UTR 100% 4.950 2.475 Y Snurf n/a
10 TRCN0000109285 CCTCCTAAAGATACTGGCATT pLKO.1 833 CDS 100% 4.050 2.025 Y Snrpn n/a
11 TRCN0000109288 GTTCAGGAAGATCAAGCCAAA pLKO.1 718 CDS 100% 4.050 2.025 Y Snrpn n/a
12 TRCN0000421269 TACACTTGAGAAGAACTACTG pLKO_005 198 5UTR 100% 4.050 2.025 Y Snurf n/a
13 TRCN0000425884 AGGTCGAGGTCCAGGTCAAAC pLKO_005 234 5UTR 100% 3.600 1.800 Y Snurf n/a
14 TRCN0000109287 CCTGCAAGATGGGAGAATCTT pLKO.1 637 CDS 100% 0.563 0.281 Y Snrpn n/a
15 TRCN0000111932 GAACTAAGACAGGCATTCTTA pLKO.1 347 5UTR 100% 0.563 0.281 Y Snurf n/a
16 TRCN0000109289 GCAAGATGGGAGAATCTTCAT pLKO.1 640 CDS 100% 0.495 0.248 Y Snrpn n/a
17 TRCN0000075135 GAATCTTCATTGGCACCTTTA pLKO.1 651 CDS 100% 10.800 5.400 Y SNRPN n/a
18 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1917 3UTR 100% 4.950 2.475 Y KAAG1 n/a
19 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 1927 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001082961.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01575 pDONR223 100% 91.5% 100% None (many diffs) n/a
2 ccsbBroad304_01575 pLX_304 0% 91.5% 100% V5 (many diffs) n/a
3 TRCN0000471606 ATAAAGGACCTTCCAAGGTTCAAG pLX_317 64.7% 91.4% 34.5% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_01568 pDONR223 100% 77.5% 88.3% None (many diffs) n/a
5 ccsbBroad304_01568 pLX_304 0% 77.5% 88.3% V5 (many diffs) n/a
6 TRCN0000473898 TGTCAGCATTCTACCTATAACCAG pLX_317 51% 77.5% 88.3% V5 (many diffs) n/a
Download CSV