Transcript: Human NM_001083585.3

Homo sapiens rabaptin, RAB GTPase binding effector protein 1 (RABEP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
RABEP1 (9135)
Length:
5810
CDS:
204..2693

Additional Resources:

NCBI RefSeq record:
NM_001083585.3
NBCI Gene record:
RABEP1 (9135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001083585.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312700 ACTGCGGGAGTTGGTATTAAA pLKO_005 2231 CDS 100% 15.000 21.000 N RABEP1 n/a
2 TRCN0000048352 CGTTGTGATATGTGTTCCAAT pLKO.1 1797 CDS 100% 4.950 3.960 N RABEP1 n/a
3 TRCN0000363576 CGTTGTGATATGTGTTCCAAT pLKO_005 1797 CDS 100% 4.950 3.960 N RABEP1 n/a
4 TRCN0000312699 CATTGGCTACTGACTGTATTT pLKO_005 3191 3UTR 100% 13.200 9.240 N RABEP1 n/a
5 TRCN0000369958 GGTTAAAGAACTGAATCATTA pLKO_005 851 CDS 100% 13.200 9.240 N RABEP1 n/a
6 TRCN0000048349 GCTGAGAAACTGCGGAAAGAA pLKO.1 957 CDS 100% 5.625 3.938 N RABEP1 n/a
7 TRCN0000327713 GCTGAGAAACTGCGGAAAGAA pLKO_005 957 CDS 100% 5.625 3.938 N RABEP1 n/a
8 TRCN0000048350 GCTGATGCTAAGGCAAGCTAA pLKO.1 1886 CDS 100% 4.950 3.465 N RABEP1 n/a
9 TRCN0000048348 GCAGTATTACAAGCTGCACAA pLKO.1 387 CDS 100% 4.050 2.835 N RABEP1 n/a
10 TRCN0000048351 GCTGTTATGAAAGAAACAGTT pLKO.1 558 CDS 100% 0.495 0.347 N RABEP1 n/a
11 TRCN0000327777 GCTGTTATGAAAGAAACAGTT pLKO_005 558 CDS 100% 0.495 0.347 N RABEP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083585.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07364 pDONR223 100% 96% 96.1% None (many diffs) n/a
2 ccsbBroad304_07364 pLX_304 0% 96% 96.1% V5 (many diffs) n/a
3 TRCN0000476250 TAGCAGAGCGGCTTTTGTGACGGT pLX_317 14% 96% 96.1% V5 (many diffs) n/a
Download CSV