Transcript: Human NM_001083961.2

Homo sapiens WD repeat domain 62 (WDR62), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
WDR62 (284403)
Length:
4727
CDS:
76..4647

Additional Resources:

NCBI RefSeq record:
NM_001083961.2
NBCI Gene record:
WDR62 (284403)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001083961.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243235 CCAAGAAGCCCTCGACCTTTA pLKO_005 4359 CDS 100% 10.800 15.120 N WDR62 n/a
2 TRCN0000243236 GTTCGGATGGACTACACTTTG pLKO_005 1913 CDS 100% 10.800 15.120 N WDR62 n/a
3 TRCN0000243237 AGGACCTGGATTGCTACTTTA pLKO_005 2714 CDS 100% 13.200 9.240 N WDR62 n/a
4 TRCN0000243234 AGTGGCTGTCCTGCGTGTATA pLKO_005 1190 CDS 100% 13.200 9.240 N WDR62 n/a
5 TRCN0000172467 CAACTGCATGAAGCAGCACTT pLKO.1 2322 CDS 100% 4.050 2.835 N WDR62 n/a
6 TRCN0000172999 CAACACCATTCGCTTCTGGAA pLKO.1 1377 CDS 100% 2.640 1.848 N WDR62 n/a
7 TRCN0000167930 CCATCCAAAGATAGCTTGGAT pLKO.1 2518 CDS 100% 0.300 0.210 N WDR62 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083961.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16147 pDONR223 0% 41.2% 41.1% None (many diffs) n/a
2 ccsbBroad304_16147 pLX_304 0% 41.2% 41.1% V5 (many diffs) n/a
3 TRCN0000473808 ATTACGGCGATGCACCGGATTGTA pLX_317 10.2% 41.2% 41.1% V5 (many diffs) n/a
Download CSV