Transcript: Human NM_001085366.1

Homo sapiens zinc finger protein 655 (ZNF655), transcript variant 9, mRNA.

Source:
NCBI, updated 2018-06-23
Taxon:
Homo sapiens (human)
Gene:
ZNF655 (79027)
Length:
1395
CDS:
394..726

Additional Resources:

NCBI RefSeq record:
NM_001085366.1
NBCI Gene record:
ZNF655 (79027)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001085366.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016686 CAGCAGGAATCTCCAAGAGAT pLKO.1 638 CDS 100% 4.950 3.465 N ZNF655 n/a
2 TRCN0000297873 CAGCAGGAATCTCCAAGAGAT pLKO_005 638 CDS 100% 4.950 3.465 N ZNF655 n/a
3 TRCN0000016684 CAAGTGCTTTCTCTGGAGAAA pLKO.1 602 CDS 100% 0.495 0.347 N ZNF655 n/a
4 TRCN0000280638 CAAGTGCTTTCTCTGGAGAAA pLKO_005 602 CDS 100% 0.495 0.347 N ZNF655 n/a
5 TRCN0000016683 CCCGGATTCATAGTGTGAATT pLKO.1 554 CDS 100% 0.000 0.000 N ZNF655 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085366.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15977 pDONR223 0% 60.7% 60.7% None 134_135ins213 n/a
2 ccsbBroad304_15977 pLX_304 0% 60.7% 60.7% V5 134_135ins213 n/a
3 ccsbBroadEn_08908 pDONR223 100% 15.5% 10.4% None (many diffs) n/a
4 ccsbBroad304_08908 pLX_304 0% 15.5% 10.4% V5 (many diffs) n/a
5 TRCN0000467232 CCATCTTTAAACGACTAACACCTT pLX_317 29.8% 15.5% 10.4% V5 (many diffs) n/a
Download CSV