Transcript: Human NM_001085411.3

Homo sapiens NAD kinase 2, mitochondrial (NADK2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
NADK2 (133686)
Length:
4011
CDS:
128..1456

Additional Resources:

NCBI RefSeq record:
NM_001085411.3
NBCI Gene record:
NADK2 (133686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001085411.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435654 AGCAGTCGTCAGCGTTGTTTC pLKO_005 1289 CDS 100% 10.800 15.120 N NADK2 n/a
2 TRCN0000128515 CTAAGCTTGAATCAGCACAAT pLKO.1 854 CDS 100% 4.950 6.930 N NADK2 n/a
3 TRCN0000024980 CGACATCATATTCACACCAAA pLKO.1 467 CDS 100% 4.950 3.960 N Nadk2 n/a
4 TRCN0000414087 GAACGGTCTGAGGGTCATTTA pLKO_005 683 CDS 100% 13.200 9.240 N NADK2 n/a
5 TRCN0000432997 GAACTGAACACATATCATTTG pLKO_005 1833 3UTR 100% 10.800 7.560 N NADK2 n/a
6 TRCN0000128286 GAGAGCACTAAATGAAGTCTT pLKO.1 943 CDS 100% 4.950 3.465 N NADK2 n/a
7 TRCN0000130907 GCTAAGCTTGAATCAGCACAA pLKO.1 853 CDS 100% 4.050 2.835 N NADK2 n/a
8 TRCN0000130058 GTATTCGAGAACCAATAGCAA pLKO.1 1254 CDS 100% 3.000 2.100 N NADK2 n/a
9 TRCN0000424042 GAGGCAGAGAATCAGGTTATA pLKO_005 781 CDS 100% 13.200 7.920 N NADK2 n/a
10 TRCN0000128285 GCAGGCTTAAATAAAGGACTA pLKO.1 1740 3UTR 100% 4.050 2.430 N NADK2 n/a
11 TRCN0000139610 CGAACTCCTGACCTTGTGATA pLKO.1 3327 3UTR 100% 4.950 2.475 Y RBM48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085411.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04884 pDONR223 100% 63.1% 63.1% None 1_489del n/a
2 TRCN0000466703 ACAAATACCTATTAGCCAATGAGA pLX_317 50.6% 63.1% 63.1% V5 1_489del n/a
3 TRCN0000487878 CTCATTTACATACACTTAACTCTT pLX_317 35.4% 63.1% 63.1% V5 (not translated due to prior stop codon) 1_489del n/a
4 TRCN0000489766 AGCCGATCCTTTATGCTTTCGTAC pLX_317 50.2% 63% 62.9% V5 1_489del;1326_1327insG n/a
Download CSV