Transcript: Human NM_001098577.2

Homo sapiens ribosomal protein L31 (RPL31), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
RPL31 (6160)
Length:
1129
CDS:
88..474

Additional Resources:

NCBI RefSeq record:
NM_001098577.2
NBCI Gene record:
RPL31 (6160)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001098577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075040 CGAAGTGGTAACCCGAGAATA pLKO.1 141 CDS 100% 13.200 9.240 N RPL31 n/a
2 TRCN0000291963 CGAAGTGGTAACCCGAGAATA pLKO_005 141 CDS 100% 13.200 9.240 N RPL31 n/a
3 TRCN0000075042 AGGAATAAGGAATGTGCCATA pLKO.1 312 CDS 100% 4.050 2.835 N RPL31 n/a
4 TRCN0000291962 AGGAATAAGGAATGTGCCATA pLKO_005 312 CDS 100% 4.050 2.835 N RPL31 n/a
5 TRCN0000075041 GCGCATTGACACCAGGCTCAA pLKO.1 273 CDS 100% 1.350 0.945 N RPL31 n/a
6 TRCN0000307902 GCGCATTGACACCAGGCTCAA pLKO_005 273 CDS 100% 1.350 0.945 N RPL31 n/a
7 TRCN0000075038 GCACTCAAAGAGATTCGGAAA pLKO.1 220 CDS 100% 4.050 2.430 N RPL31 n/a
8 TRCN0000291964 GCACTCAAAGAGATTCGGAAA pLKO_005 220 CDS 100% 4.050 2.430 N RPL31 n/a
9 TRCN0000188224 CCATCAACATTCACAAGCGCA pLKO.1 164 CDS 100% 0.660 0.396 N RPL31P50 n/a
10 TRCN0000075039 CCGAGAATACACCATCAACAT pLKO.1 153 CDS 100% 4.950 2.475 Y RPL31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01433 pDONR223 100% 93.3% 92.1% None (many diffs) n/a
2 ccsbBroad304_01433 pLX_304 0% 93.3% 92.1% V5 (many diffs) n/a
3 TRCN0000468634 ACAACCATTAGTATCTCTTACACA pLX_317 100% 93.3% 92.1% V5 (many diffs) n/a
Download CSV