Transcript: Human NM_001099285.1

Homo sapiens prothymosin alpha (PTMA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
PTMA (5757)
Length:
1223
CDS:
183..518

Additional Resources:

NCBI RefSeq record:
NM_001099285.1
NBCI Gene record:
PTMA (5757)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001099285.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416629 ATCACCACCAAGGACTTAAAG pLKO_005 216 CDS 100% 13.200 10.560 N PTMA n/a
2 TRCN0000135421 GTAGACGAAGAAGAGGAAGAA pLKO.1 339 CDS 100% 4.950 3.465 N PTMA n/a
3 TRCN0000133816 CCAAACCATGAGAATTTGCAA pLKO.1 686 3UTR 100% 3.000 2.100 N PTMA n/a
4 TRCN0000138750 GAAGTTGTGGAAGAGGCAGAA pLKO.1 246 CDS 100% 4.050 2.430 N PTMA n/a
5 TRCN0000138711 GAAGATGAGGAAGCTGAGTCA pLKO.1 417 CDS 100% 2.640 1.584 N PTMA n/a
6 TRCN0000138955 GATGAGGATGACGATGTCGAT pLKO.1 465 CDS 100% 2.640 1.584 N PTMA n/a
7 TRCN0000429553 TATTCCGAGCATTCCAGTAAC pLKO_005 985 3UTR 100% 10.800 5.400 Y PTMA n/a
8 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 369 CDS 100% 4.950 2.475 Y PTMA n/a
9 TRCN0000125359 CTGTACTATAAGTAGTTGGTT pLKO.1 1026 3UTR 100% 3.000 1.500 Y Ptma n/a
10 TRCN0000136081 GAAGATGATGAGGATGACGAT pLKO.1 459 CDS 100% 2.640 1.320 Y PTMA n/a
11 TRCN0000138110 GCAGCTGAAGATGATGAGGAT pLKO.1 453 CDS 100% 2.640 1.320 Y PTMA n/a
12 TRCN0000134223 GCTGTACTATAAGTAGTTGGT pLKO.1 1025 3UTR 100% 2.640 1.320 Y PTMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099285.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01339 pDONR223 100% 99% 99% None 118_120delGAG n/a
2 ccsbBroad304_01339 pLX_304 0% 99% 99% V5 118_120delGAG n/a
3 TRCN0000475496 AATGTAGACTACCTTGACCGGGAC pLX_317 64.5% 99% 99% V5 118_120delGAG n/a
4 ccsbBroadEn_15553 pDONR223 0% 98.4% 98.1% None 118_120delGAG;222A>G;227A>G n/a
5 ccsbBroad304_15553 pLX_304 0% 98.4% 98.1% V5 118_120delGAG;222A>G;227A>G n/a
6 TRCN0000478994 AAGACCGGGAGATGACTCTCGTTT pLX_317 100% 98.4% 98.1% V5 118_120delGAG;222A>G;227A>G n/a
Download CSV