Transcript: Human NM_001099406.1

Homo sapiens solute carrier family 39 member 6 (SLC39A6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
SLC39A6 (25800)
Length:
1681
CDS:
318..1619

Additional Resources:

NCBI RefSeq record:
NM_001099406.1
NBCI Gene record:
SLC39A6 (25800)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001099406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365071 ATCATGACTACCATCATATTC pLKO_005 1165 CDS 100% 13.200 18.480 N SLC39A6 n/a
2 TRCN0000038482 GCCTCATGAATTAGGTGACTT pLKO.1 1403 CDS 100% 4.950 6.930 N SLC39A6 n/a
3 TRCN0000038483 CCTCTCATGAATCGGGTGTTT pLKO.1 531 CDS 100% 4.950 3.960 N SLC39A6 n/a
4 TRCN0000376539 GATCGAACTGAAGGCTATTTA pLKO_005 954 CDS 100% 15.000 10.500 N SLC39A6 n/a
5 TRCN0000365027 TGACTTTGCTGTTCTACTAAA pLKO_005 1418 CDS 100% 13.200 9.240 N SLC39A6 n/a
6 TRCN0000370059 ATGCAACAGAGTTCAACTATC pLKO_005 340 CDS 100% 10.800 7.560 N SLC39A6 n/a
7 TRCN0000038480 CCACAGGAAGTCTACAATGAA pLKO.1 1062 CDS 100% 5.625 3.938 N SLC39A6 n/a
8 TRCN0000038479 GCCATCATCAACCAAATTGAT pLKO.1 369 CDS 100% 0.563 0.394 N SLC39A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02854 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02854 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471002 CCACCTAAGTCAATCTTTTAGAAT pLX_317 31.3% 100% 100% V5 n/a
Download CSV