Transcript: Mouse NM_001099628.1

Mus musculus ATPase family, AAA domain containing 2B (Atad2b), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Atad2b (320817)
Length:
8102
CDS:
357..4739

Additional Resources:

NCBI RefSeq record:
NM_001099628.1
NBCI Gene record:
Atad2b (320817)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001099628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328773 CGAAGAACAGTACCGAGTATT pLKO_005 2832 CDS 100% 13.200 18.480 N Atad2b n/a
2 TRCN0000328862 GTGGATTGAGCCATCATATTC pLKO_005 1561 CDS 100% 13.200 18.480 N Atad2b n/a
3 TRCN0000336621 GTGGATTGAGCCATCATATTC pLKO_005 1561 CDS 100% 13.200 18.480 N ATAD2B n/a
4 TRCN0000198854 CGAAGTAGAGAGGCTTCGAAT pLKO.1 989 CDS 100% 0.495 0.693 N Atad2b n/a
5 TRCN0000328828 CTTATGGATGGATTAGATAAT pLKO_005 1947 CDS 100% 13.200 10.560 N Atad2b n/a
6 TRCN0000328774 GCTCTTTGATCAGGCATATTT pLKO_005 1820 CDS 100% 15.000 10.500 N Atad2b n/a
7 TRCN0000216017 CCTTATGGATGGATTAGATAA pLKO.1 1946 CDS 100% 13.200 9.240 N Atad2b n/a
8 TRCN0000215698 CTTCATCAACTATGGTCTATT pLKO.1 7896 3UTR 100% 13.200 9.240 N Atad2b n/a
9 TRCN0000353534 TAGAATTGGCTATGGTGTATT pLKO_005 5238 3UTR 100% 13.200 9.240 N Atad2b n/a
10 TRCN0000021131 CCTCATCTGTAGCAATGCTTT pLKO.1 3446 CDS 100% 4.950 3.465 N ATAD2B n/a
11 TRCN0000197755 GAATGTGGACAGATACAGAAT pLKO.1 1006 CDS 100% 4.950 3.465 N Atad2b n/a
12 TRCN0000198278 GATGGAGACATAGAGGTTGAA pLKO.1 1152 CDS 100% 4.950 3.465 N Atad2b n/a
13 TRCN0000178255 GAAGAATCTCAAGAGGAGGAT pLKO.1 1134 CDS 100% 2.640 1.848 N Atad2b n/a
14 TRCN0000177307 GAGAAGAAATAGTTATGGGAT pLKO.1 1076 CDS 100% 2.640 1.848 N Atad2b n/a
15 TRCN0000181362 CCGATGAACTTCAGAGCAGAA pLKO.1 1437 CDS 100% 4.050 2.430 N Atad2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.