Transcript: Human NM_001100176.2

Homo sapiens hook microtubule tethering protein 2 (HOOK2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
HOOK2 (29911)
Length:
2536
CDS:
104..2257

Additional Resources:

NCBI RefSeq record:
NM_001100176.2
NBCI Gene record:
HOOK2 (29911)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001100176.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141045 CGCAGGTACTATTTCCTAAGT pLKO.1 626 CDS 100% 4.950 6.930 N HOOK2 n/a
2 TRCN0000140902 CAGAGAATCATGACGCTGGAA pLKO.1 500 CDS 100% 2.640 2.112 N HOOK2 n/a
3 TRCN0000139184 CCAGAGACGTATGGCAACTTT pLKO.1 593 CDS 100% 5.625 3.938 N HOOK2 n/a
4 TRCN0000139525 CCTGGAGATGGACTTTGAGAA pLKO.1 2029 CDS 100% 4.950 3.465 N HOOK2 n/a
5 TRCN0000141531 GCAGCATAACTTGCAGAAGAA pLKO.1 1843 CDS 100% 4.950 3.465 N HOOK2 n/a
6 TRCN0000140795 GCTGAAGGTCAGCAATCTGAA pLKO.1 301 CDS 100% 4.950 3.465 N HOOK2 n/a
7 TRCN0000139114 CAGAAGCTTCATGAGGCAGAT pLKO.1 1739 CDS 100% 4.050 2.835 N HOOK2 n/a
8 TRCN0000140000 GTTCAGCATGTGGTGATGGAA pLKO.1 527 CDS 100% 3.000 2.100 N HOOK2 n/a
9 TRCN0000139843 CTGGAAGAATCGGTTCAGCAT pLKO.1 515 CDS 100% 2.640 1.848 N HOOK2 n/a
10 TRCN0000140075 GCTATTTGAATGCCGCAACCT pLKO.1 1261 CDS 100% 2.640 1.848 N HOOK2 n/a
11 TRCN0000141955 GAGGAACATTTGCAGAAGCTT pLKO.1 1727 CDS 100% 3.000 1.800 N HOOK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001100176.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08137 pDONR223 100% 99.9% 99.8% None 1464C>G n/a
2 ccsbBroad304_08137 pLX_304 0% 99.9% 99.8% V5 1464C>G n/a
3 TRCN0000474500 GTGCCTTTCCGCTCGCGTGGTTTC pLX_317 23.9% 99.9% 99.8% V5 1464C>G n/a
Download CSV