Transcript: Mouse NM_001101561.2

Mus musculus ribosomal protein L32-like (Rpl32l), mRNA.

Source:
NCBI, updated 2015-11-11
Taxon:
Mus musculus (mouse)
Gene:
Rpl32l (621697)
Length:
592
CDS:
52..453

Additional Resources:

NCBI RefSeq record:
NM_001101561.2
NBCI Gene record:
Rpl32l (621697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001101561.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270119 AGACACCAGTCAGACCGATAT pLKO_005 115 CDS 100% 10.800 6.480 N Gm4987 n/a
2 TRCN0000271056 CTGATGTGCAACAGATCTTAC pLKO_005 310 CDS 100% 10.800 6.480 N Rpl32l n/a
3 TRCN0000271054 GACACCAGTCAGACCGATATG pLKO_005 116 CDS 100% 10.800 6.480 N Rpl32l n/a
4 TRCN0000284291 GCAAGTTCCTGGTCCACAATG pLKO_005 269 CDS 100% 10.800 5.400 Y Rpl32l n/a
5 TRCN0000271053 CTGATGCCCAACATCGGTTAC pLKO_005 205 CDS 100% 6.000 3.000 Y Rpl32l n/a
6 TRCN0000011880 CGCAAGTTCCTGGTCCACAAT pLKO.1 268 CDS 100% 4.950 2.475 Y Rpl32 n/a
7 TRCN0000011882 CTGTGCTGAGATTGCTCACAA pLKO.1 330 CDS 100% 4.950 2.475 Y Rpl32 n/a
8 TRCN0000271055 ATTAAGCGAAACTGGCGGAAA pLKO_005 142 CDS 100% 4.050 2.025 Y Rpl32l n/a
9 TRCN0000011881 CTGATGCCCAACATCGGTTAT pLKO.1 205 CDS 100% 10.800 5.400 Y Rpl32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101561.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01434 pDONR223 100% 87.4% 94% None (many diffs) n/a
2 ccsbBroad304_01434 pLX_304 0% 87.4% 94% V5 (many diffs) n/a
3 TRCN0000465721 TGTTGTTCGTTATACTAAATGTCT pLX_317 95.5% 87.4% 94% V5 (many diffs) n/a
4 ccsbBroadEn_13168 pDONR223 100% 21.8% 24% None (many diffs) n/a
5 ccsbBroad304_13168 pLX_304 0% 21.8% 24% V5 (many diffs) n/a
Download CSV