Transcript: Human NM_001102.4

Homo sapiens actinin alpha 1 (ACTN1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
ACTN1 (87)
Length:
3656
CDS:
247..2925

Additional Resources:

NCBI RefSeq record:
NM_001102.4
NBCI Gene record:
ACTN1 (87)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001102.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330524 ACGGCGAGAGTGACCTCTAAT pLKO_005 2906 CDS 100% 13.200 18.480 N ACTN1 n/a
2 TRCN0000055825 CCAGACCTACCACGTCAATAT pLKO.1 1983 CDS 100% 13.200 18.480 N ACTN1 n/a
3 TRCN0000353679 TCCAGACCTACCACGTCAATA pLKO_005 1982 CDS 100% 13.200 18.480 N ACTN1 n/a
4 TRCN0000330526 ATTAACTATTTGCACCGAAAT pLKO_005 3203 3UTR 100% 10.800 15.120 N ACTN1 n/a
5 TRCN0000330525 CTCAATGAGCTGGACTATTAT pLKO_005 1627 CDS 100% 15.000 10.500 N ACTN1 n/a
6 TRCN0000330527 TCACGCCTCAGGAGATCAATG pLKO_005 2030 CDS 100% 10.800 7.560 N ACTN1 n/a
7 TRCN0000055823 CCTCAGGAGATCAATGGCAAA pLKO.1 2035 CDS 100% 4.050 2.835 N ACTN1 n/a
8 TRCN0000055824 CGAAGAAATCGTGGATGGGAA pLKO.1 582 CDS 100% 2.640 1.848 N ACTN1 n/a
9 TRCN0000055827 GCATCGTCAACTACAAGCCAA pLKO.1 2276 CDS 100% 2.640 1.848 N ACTN1 n/a
10 TRCN0000055826 CCATCATGACTTACGTGTCTA pLKO.1 956 CDS 100% 4.950 2.475 Y ACTN1 n/a
11 TRCN0000054660 GCGACAGAAGGACTATGAGTT pLKO.1 1497 CDS 100% 4.950 3.465 N Nfe2l2 n/a
12 TRCN0000090217 CCTTCATTGACTTCATGTCAA pLKO.1 2678 CDS 100% 0.495 0.297 N Actn4 n/a
13 TRCN0000309799 CCTTCATTGACTTCATGTCAA pLKO_005 2678 CDS 100% 0.495 0.297 N Actn4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001102.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00016 pDONR223 100% 80.2% 84.1% None (many diffs) n/a
2 ccsbBroad304_00016 pLX_304 0% 80.2% 84.1% V5 (many diffs) n/a
3 TRCN0000478445 AACAATATTTTCATGGGGTGCCTC pLX_317 12.7% 80.2% 84.1% V5 (many diffs) n/a
Download CSV