Transcript: Human NM_001102576.3

Homo sapiens chondrosarcoma associated gene 1 (CSAG1), transcript variant c, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
CSAG1 (158511)
Length:
645
CDS:
99..335

Additional Resources:

NCBI RefSeq record:
NM_001102576.3
NBCI Gene record:
CSAG1 (158511)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001102576.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165875 GAGTAGACTGTACAGAGACAC pLKO.1 170 CDS 100% 4.050 2.835 N CSAG1 n/a
2 TRCN0000165653 GACTGGAGTAGACTGTACAGA pLKO.1 165 CDS 100% 3.000 2.100 N CSAG1 n/a
3 TRCN0000165732 CAACCACCCATCAACACCAAA pLKO.1 242 CDS 100% 4.950 2.970 N CSAG1 n/a
4 TRCN0000164784 CCCATCAACACCAAAGAGGTT pLKO.1 248 CDS 100% 2.640 1.584 N CSAG1 n/a
5 TRCN0000163988 CAAGGAAGTTCCAGGAACAAA pLKO.1 302 CDS 100% 5.625 2.813 Y CSAG1 n/a
6 TRCN0000115812 CGAACGAGGAACTCAATCAAA pLKO.1 403 3UTR 100% 5.625 2.813 Y CSAG2 n/a
7 TRCN0000115816 CCAAAGAGGTTCCCAAGACAA pLKO.1 258 CDS 100% 4.950 2.475 Y CSAG2 n/a
8 TRCN0000165409 CCAAAGAGGTTCCCAAGACAA pLKO.1 258 CDS 100% 4.950 2.475 Y CSAG1 n/a
9 TRCN0000164670 CTGGTGAAGATGTCCAGGAAA pLKO.1 195 CDS 100% 4.950 2.475 Y CSAG1 n/a
10 TRCN0000183478 GAGACTTCAAGTCTATCTGAA pLKO.1 511 3UTR 100% 4.950 2.475 Y CSAG3 n/a
11 TRCN0000165488 GTCAAGGAAGTTCCAGGAACA pLKO.1 300 CDS 100% 4.050 2.025 Y CSAG1 n/a
12 TRCN0000166706 CAACACCAAAGAGGTTCCCAA pLKO.1 253 CDS 100% 2.640 1.320 Y CSAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001102576.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09724 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_09724 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_05732 pDONR223 100% 66% 59% None (many diffs) n/a
4 ccsbBroad304_05732 pLX_304 0% 66% 59% V5 (many diffs) n/a
5 TRCN0000469134 GATCCATCCTAGTGGCTCACGGAC pLX_317 100% 66% 59% V5 (many diffs) n/a
Download CSV