Transcript: Mouse NM_001103182.2

Mus musculus lin-9 homolog (C. elegans) (Lin9), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Lin9 (72568)
Length:
3178
CDS:
170..1846

Additional Resources:

NCBI RefSeq record:
NM_001103182.2
NBCI Gene record:
Lin9 (72568)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001103182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125122 CTCGGAGATGTTCTTCTGCAT pLKO.1 735 CDS 100% 2.640 2.112 N Lin9 n/a
2 TRCN0000288241 CTCGGAGATGTTCTTCTGCAT pLKO_005 735 CDS 100% 2.640 2.112 N Lin9 n/a
3 TRCN0000125119 CCAGGTGACTAAGTTATCAAA pLKO.1 1249 CDS 100% 5.625 3.938 N Lin9 n/a
4 TRCN0000288177 CCAGGTGACTAAGTTATCAAA pLKO_005 1249 CDS 100% 5.625 3.938 N Lin9 n/a
5 TRCN0000115876 CCTGTTTGGAAAGGCAGGAAT pLKO.1 335 CDS 100% 4.950 3.465 N LIN9 n/a
6 TRCN0000125120 GCATTGAGTTTCAGCGGAGAT pLKO.1 1359 CDS 100% 4.050 2.835 N Lin9 n/a
7 TRCN0000288178 GCATTGAGTTTCAGCGGAGAT pLKO_005 1359 CDS 100% 4.050 2.835 N Lin9 n/a
8 TRCN0000125123 CAATTACAGATGGCGATCCTT pLKO.1 1146 CDS 100% 3.000 2.100 N Lin9 n/a
9 TRCN0000288180 CAATTACAGATGGCGATCCTT pLKO_005 1146 CDS 100% 3.000 2.100 N Lin9 n/a
10 TRCN0000125121 CCTAAAGGAATCCTTTCCTAA pLKO.1 652 CDS 100% 0.495 0.347 N Lin9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001103182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05418 pDONR223 100% 90.2% 97.1% None (many diffs) n/a
2 ccsbBroad304_05418 pLX_304 0% 90.2% 97.1% V5 (many diffs) n/a
3 TRCN0000477195 AGCCGCGAGTGTTGAGATGACAAT pLX_317 16.3% 90.2% 97.1% V5 (many diffs) n/a
Download CSV