Transcript: Human NM_001105250.3

Homo sapiens neurexin 3 (NRXN3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
NRXN3 (9369)
Length:
8619
CDS:
913..2292

Additional Resources:

NCBI RefSeq record:
NM_001105250.3
NBCI Gene record:
NRXN3 (9369)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001105250.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094192 GCTCTATTATGATGGTTTGAA pLKO.1 1692 CDS 100% 5.625 4.500 N Nrxn3 n/a
2 TRCN0000063568 CCCAGGATCTAATTTCAGAAT pLKO.1 3127 3UTR 100% 4.950 3.465 N NRXN3 n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5336 3UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5336 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001105250.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07403 pDONR223 100% 92.7% 92.6% None 600_689del;1075_1076insCAGGTAGGT;1369T>C n/a
2 ccsbBroad304_07403 pLX_304 0% 92.7% 92.6% V5 600_689del;1075_1076insCAGGTAGGT;1369T>C n/a
3 TRCN0000470067 ATGCCACCTGACTCGACGTACTGA pLX_317 20.4% 92.7% 92.6% V5 600_689del;1075_1076insCAGGTAGGT;1369T>C n/a
Download CSV