Construct: ORF TRCN0000470067
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015427.1_s317c1
- Derived from:
- ccsbBroadEn_07403
- DNA Barcode:
- ATGCCACCTGACTCGACGTACTGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NRXN3 (9369)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470067
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9369 | NRXN3 | neurexin 3 | NM_138970.5 | 99.9% | 99.7% | 1288T>C |
2 | human | 9369 | NRXN3 | neurexin 3 | NM_001105250.3 | 92.7% | 92.6% | 600_689del;1075_1076insCAGGTAGGT;1369T>C |
3 | human | 9369 | NRXN3 | neurexin 3 | NM_001272020.2 | 67.6% | 67.3% | 989_990insT;994_1609del;1903T>C |
4 | human | 9369 | NRXN3 | neurexin 3 | NM_004796.6 | 37.8% | 33.3% | (many diffs) |
5 | human | 9369 | NRXN3 | neurexin 3 | XM_024449753.1 | 28.2% | 24.9% | (many diffs) |
6 | human | 9369 | NRXN3 | neurexin 3 | XM_017021807.1 | 28% | 24.7% | (many diffs) |
7 | human | 9369 | NRXN3 | neurexin 3 | XM_011537373.1 | 27.8% | 24.5% | (many diffs) |
8 | human | 9369 | NRXN3 | neurexin 3 | XM_017021805.1 | 27.4% | 24.2% | (many diffs) |
9 | human | 9369 | NRXN3 | neurexin 3 | XM_011537371.1 | 27.4% | 24.2% | (many diffs) |
10 | human | 9369 | NRXN3 | neurexin 3 | XM_017021804.1 | 27.4% | 24.2% | (many diffs) |
11 | human | 9369 | NRXN3 | neurexin 3 | NM_001366426.1 | 27.4% | 24.1% | (many diffs) |
12 | human | 9369 | NRXN3 | neurexin 3 | XM_024449752.1 | 27.3% | 24.1% | (many diffs) |
13 | human | 9369 | NRXN3 | neurexin 3 | XM_011537372.1 | 27.2% | 24% | (many diffs) |
14 | human | 9369 | NRXN3 | neurexin 3 | NM_001366425.1 | 26.3% | 23.1% | (many diffs) |
15 | human | 9369 | NRXN3 | neurexin 3 | XM_017021801.1 | 26.2% | 23.1% | (many diffs) |
16 | human | 9369 | NRXN3 | neurexin 3 | XM_017021800.1 | 26.1% | 22.9% | (many diffs) |
17 | human | 9369 | NRXN3 | neurexin 3 | XM_024449751.1 | 24.8% | 21.9% | (many diffs) |
18 | human | 9369 | NRXN3 | neurexin 3 | XM_024449750.1 | 24.6% | 21.8% | (many diffs) |
19 | human | 9369 | NRXN3 | neurexin 3 | XM_017021799.2 | 24.5% | 21.6% | (many diffs) |
20 | human | 9369 | NRXN3 | neurexin 3 | XM_011537367.1 | 24.5% | 21.6% | (many diffs) |
21 | human | 9369 | NRXN3 | neurexin 3 | XR_001750607.1 | 13.3% | (many diffs) | |
22 | human | 9369 | NRXN3 | neurexin 3 | XR_001750606.1 | 13.3% | (many diffs) | |
23 | human | 9369 | NRXN3 | neurexin 3 | NR_073546.2 | 13% | (many diffs) | |
24 | human | 9369 | NRXN3 | neurexin 3 | NR_158975.1 | 9.4% | (many diffs) | |
25 | mouse | 18191 | Nrxn3 | neurexin III | XM_006515569.3 | 91.6% | 97.6% | (many diffs) |
26 | mouse | 18191 | Nrxn3 | neurexin III | XM_017314989.1 | 85.7% | 91.3% | (many diffs) |
27 | mouse | 18191 | Nrxn3 | neurexin III | XM_006515568.3 | 85% | 90.6% | (many diffs) |
28 | mouse | 18191 | Nrxn3 | neurexin III | NM_001252074.2 | 69.6% | 74.1% | (many diffs) |
29 | mouse | 18191 | Nrxn3 | neurexin III | XM_006515567.3 | 62.1% | 65.9% | (many diffs) |
30 | mouse | 18191 | Nrxn3 | neurexin III | XM_017314988.1 | 59.3% | 62.9% | (many diffs) |
31 | mouse | 18191 | Nrxn3 | neurexin III | NM_172544.3 | 33.3% | 31.9% | (many diffs) |
32 | mouse | 18191 | Nrxn3 | neurexin III | XM_017314987.1 | 31.4% | 30.1% | (many diffs) |
33 | mouse | 18191 | Nrxn3 | neurexin III | XM_006515560.2 | 25.4% | 24.2% | (many diffs) |
34 | mouse | 18191 | Nrxn3 | neurexin III | XM_006515570.1 | 25.3% | 24.1% | (many diffs) |
35 | mouse | 18191 | Nrxn3 | neurexin III | XM_006515558.1 | 25% | 23.9% | (many diffs) |
36 | mouse | 18191 | Nrxn3 | neurexin III | XM_017314983.1 | 24.9% | 23.7% | (many diffs) |
37 | mouse | 18191 | Nrxn3 | neurexin III | XM_006515559.2 | 24.8% | 23.7% | (many diffs) |
38 | mouse | 18191 | Nrxn3 | neurexin III | XM_017314982.1 | 23.9% | 22.9% | (many diffs) |
39 | mouse | 18191 | Nrxn3 | neurexin III | XM_006515552.1 | 22.6% | 21.6% | (many diffs) |
40 | mouse | 18191 | Nrxn3 | neurexin III | XM_006515551.1 | 22.3% | 21.4% | (many diffs) |
41 | mouse | 18191 | Nrxn3 | neurexin III | XR_001780426.1 | 12.1% | (many diffs) | |
42 | mouse | 18191 | Nrxn3 | neurexin III | XR_381485.1 | 12.1% | (many diffs) | |
43 | mouse | 18191 | Nrxn3 | neurexin III | XR_001780425.1 | 12.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1362
- ORF length:
- 1296
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca cctgagaatc cacgcgagac ggagccctcc tcgccggccg gcctggacgc 121 ttgggatctg gttcctgttc tggggatgta tcgtcagctc tgtatggagt tcttctaatg 181 tagcttcctc ctcctccacc tcttcctcgc cggggtctca ctctcagcac gagcaccatt 241 tccatggcag caagcatcac tcagtgccta tttctatcta tcgttcccct gtttcccttc 301 gaggaggaca cgctggcgct acgtacatct ttgggaaaag tggtgggctt atcctctaca 361 cctggccagc caatgacagg cccagcacgc ggtctgaccg ccttgccgtg ggcttcagca 421 ccactgtgaa ggatggcatc ttggtccgca tcgacagtgc tccaggactt ggtgacttcc 481 tccagcttca catagaacag gggaaaattg gagttgtctt caacattggc acagttgaca 541 tctccatcaa agaggagaga acccctgtaa atgacggcaa ataccatgtg gtacgcttca 601 ccaggaacgg cggcaacgcc accctgcagg tggacaactg gccagtgaat gaacattatc 661 ctacaggccg gcagttaacc atcttcaaca ctcaggcgca aatagccatt ggtggaaagg 721 acaaaggacg cctcttccaa ggccaactct ctgggctcta ttatgatggt ttgaaagtac 781 tgaacatggc ggctgagaac aaccccaata ttaaaatcaa tggaagtgtt cggctggttg 841 gagaagtccc atcaattttg ggaacaacac agacgacctc catgccacca gaaatgtcta 901 ctactgtcat ggaaaccact actacaatgg cgactaccac aacccgtaag aatcgctcta 961 cagccagcat tcagccaaca tcagatgatc ttgtttcatc tgctgaatgt tcaagtgatg 1021 atgaagactt tgttgaatgt gagccgagta caggtaggtc agcaaacccc acggagccgg 1081 gaatcagacg ggttccgggg gccTCAGAGG TGATCCGGGA GTCGAGCAGC ACAACAGGGA 1141 TGGTCGTCGG CATTGTGGCT GCTGCCGCCC TCTGCATCTT GATCCTCCTG TACGCCATGT 1201 ACAAGTACAG GAACAGGGAC GAGGGGTCCT ATCAAGTGGA CGAGACGCGG AACTACATCA 1261 GCAACTCCGC CCAGAGCAAC GGCACGCTCA TGAAGGAGAA GCAGCAGAGC TCGAAGAGCG 1321 GCCACAAGAA ACAGAAAAAC AAGGACAGGG AGCATTACGT GTACCCAACT TTCTTGTACA 1381 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1441 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1501 AGGACGAATG CCACCTGACT CGACGTACTG AACGCGTTAA GTCgacaatc aacctctgga 1561 ttacaaaatt tgtgaaagat t