Transcript: Mouse NM_001110227.2

Mus musculus potassium inwardly-rectifying channel, subfamily J, member 13 (Kcnj13), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Kcnj13 (100040591)
Length:
3056
CDS:
135..1217

Additional Resources:

NCBI RefSeq record:
NM_001110227.2
NBCI Gene record:
Kcnj13 (100040591)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110227.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044551 CGCCTTACTTGCCATACAAAT pLKO.1 539 CDS 100% 13.200 18.480 N KCNJ13 n/a
2 TRCN0000262099 CGCCTTACTTGCCATACAAAT pLKO_005 539 CDS 100% 13.200 18.480 N Kcnj13 n/a
3 TRCN0000262096 ATCATGTTACATCACCGATTT pLKO_005 1011 CDS 100% 10.800 15.120 N Kcnj13 n/a
4 TRCN0000262097 CTAACCTATTACCATACTATC pLKO_005 855 CDS 100% 10.800 15.120 N Kcnj13 n/a
5 TRCN0000262095 ACACAGGACTGACCTAGATAT pLKO_005 1136 CDS 100% 13.200 9.240 N Kcnj13 n/a
6 TRCN0000262098 ACACAACTTACAATTGGTTAT pLKO_005 480 CDS 100% 10.800 7.560 N Kcnj13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110227.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06482 pDONR223 100% 89.9% 92.5% None (many diffs) n/a
2 ccsbBroad304_06482 pLX_304 0% 89.9% 92.5% V5 (many diffs) n/a
3 TRCN0000471741 CTCCGCTTACACCTAAGTAACTTA pLX_317 47% 89.9% 92.5% V5 (many diffs) n/a
Download CSV