Transcript: Mouse NM_001111022.2

Mus musculus runt related transcription factor 1 (Runx1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Mus musculus (mouse)
Gene:
Runx1 (12394)
Length:
5611
CDS:
200..1405

Additional Resources:

NCBI RefSeq record:
NM_001111022.2
NBCI Gene record:
Runx1 (12394)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001111022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084809 CGGCAGAACTGAGAAATGCTA pLKO.1 582 CDS 100% 3.000 4.200 N Runx1 n/a
2 TRCN0000084811 GTCTTTACAAATCCGCCACAA pLKO.1 695 CDS 100% 4.050 3.240 N Runx1 n/a
3 TRCN0000229575 CTCGCCCTCCTACCATCTATA pLKO_005 1162 CDS 100% 13.200 9.240 N Runx1 n/a
4 TRCN0000229572 CTCTGACCATCACCGTCTTTA pLKO_005 681 CDS 100% 13.200 9.240 N Runx1 n/a
5 TRCN0000218119 TATAGCCAAAGCTGATCATTT pLKO_005 4691 3UTR 100% 13.200 9.240 N Runx1 n/a
6 TRCN0000229574 CAGCCTCTCTGCAGAACTTTC pLKO_005 901 CDS 100% 10.800 7.560 N Runx1 n/a
7 TRCN0000229573 ACAAGTTGCCACCTACCATAG pLKO_005 712 CDS 100% 6.000 4.200 N Runx1 n/a
8 TRCN0000084808 CCACAAAGAAATCCCTAGATA pLKO.1 1926 3UTR 100% 5.625 3.938 N Runx1 n/a
9 TRCN0000084810 GCCCTCCTACCATCTATACTA pLKO.1 1165 CDS 100% 5.625 3.938 N Runx1 n/a
10 TRCN0000084812 CACCTACCATAGAGCCATCAA pLKO.1 721 CDS 100% 4.950 3.465 N Runx1 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4029 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000013662 CACAGTGCTTCATGAGAGAAT pLKO.1 240 CDS 100% 4.950 3.465 N RUNX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001111022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00229 pDONR223 100% 75.8% 79.7% None (many diffs) n/a
2 TRCN0000476234 ATTTCTAGGCCACCTCGTTGAGCA pLX_317 15.9% 75.8% 79.7% V5 (many diffs) n/a
Download CSV