Construct: ORF TRCN0000476234
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004283.1_s317c1
- Derived from:
- ccsbBroadEn_00229
- DNA Barcode:
- ATTTCTAGGCCACCTCGTTGAGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RUNX1 (861)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476234
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 861 | RUNX1 | RUNX family transcription f... | NM_001754.4 | 100% | 100% | |
| 2 | human | 861 | RUNX1 | RUNX family transcription f... | XM_011529766.2 | 100% | 100% | |
| 3 | human | 861 | RUNX1 | RUNX family transcription f... | XM_011529767.2 | 97.2% | 97.2% | 57_58ins39 |
| 4 | human | 861 | RUNX1 | RUNX family transcription f... | XM_005261068.3 | 95.3% | 94.1% | (many diffs) |
| 5 | human | 861 | RUNX1 | RUNX family transcription f... | NM_001001890.3 | 93.8% | 93.5% | (many diffs) |
| 6 | human | 861 | RUNX1 | RUNX family transcription f... | XM_017028487.1 | 89.3% | 89.3% | 0_1ins153 |
| 7 | human | 861 | RUNX1 | RUNX family transcription f... | XM_005261069.4 | 86.6% | 86.4% | 613_614ins192 |
| 8 | human | 861 | RUNX1 | RUNX family transcription f... | XM_011529768.2 | 83.9% | 83.7% | 57_58ins39;574_575ins192 |
| 9 | human | 861 | RUNX1 | RUNX family transcription f... | XM_011529770.2 | 57.2% | 56.2% | (many diffs) |
| 10 | human | 861 | RUNX1 | RUNX family transcription f... | NM_001122607.2 | 51.2% | 49.7% | (many diffs) |
| 11 | human | 861 | RUNX1 | RUNX family transcription f... | XR_937576.2 | 27.2% | (many diffs) | |
| 12 | mouse | 12394 | Runx1 | runt related transcription ... | NM_001111021.2 | 88.6% | 93.3% | (many diffs) |
| 13 | mouse | 12394 | Runx1 | runt related transcription ... | NM_001111023.2 | 85.4% | 89.5% | (many diffs) |
| 14 | mouse | 12394 | Runx1 | runt related transcription ... | NM_001111022.2 | 75.8% | 79.7% | (many diffs) |
| 15 | mouse | 12394 | Runx1 | runt related transcription ... | NM_009821.3 | 72.6% | 76% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1509
- ORF length:
- 1440
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcttcagac agcatatttg agtcatttcc ttcgtaccca cagtgcttca 121 tgagagaatg catacttgga atgaatcctt ctagagacgt ccacgatgcc agcacgagcc 181 gccgcttcac gccgccttcc accgcgctga gcccaggcaa gatgagcgag gcgttgccgc 241 tgggcgcccc ggacgccggc gctgccctgg ccggcaagct gaggagcggc gaccgcagca 301 tggtggaggt gctggccgac cacccgggcg agctggtgcg caccgacagc cccaacttcc 361 tctgctccgt gctgcctacg cactggcgct gcaacaagac cctgcccatc gctttcaagg 421 tggtggccct aggggatgtt ccagatggca ctctggtcac tgtgatggct ggcaatgatg 481 aaaactactc ggctgagctg agaaatgcta ccgcagccat gaagaaccag gttgcaagat 541 ttaatgacct caggtttgtc ggtcgaagtg gaagagggaa aagcttcact ctgaccatca 601 ctgtcttcac aaacccaccg caagtcgcca cctaccacag agccatcaaa atcacagtgg 661 atgggccccg agaacctcga agacatcggc agaaactaga tgatcagacc aagcccggga 721 gcttgtcctt ttccgagcgg ctcagtgaac tggagcagct gcggcgcaca gccatgaggg 781 tcagcccaca ccacccagcc cccacgccca accctcgtgc ctccctgaac cactccactg 841 cctttaaccc tcagcctcag agtcagatgc aggatacaag gcagatccaa ccatccccac 901 cgtggtccta cgatcagtcc taccaatacc tgggatccat tgcctctcct tctgtgcacc 961 cagcaacgcc catttcacct ggacgtgcca gcggcatgac aaccctctct gcagaacttt 1021 ccagtcgact ctcaacggca cccgacctga cagcgttcag cgacccgcgc cagttccccg 1081 cgctgccctc catctccgac ccccgcatgc actatccagg cgccttcacc tactccccga 1141 cgccggtcac ctcgggcatc ggcatcggca tgtcggccat gggctcggcc acgcgctacc 1201 acacctacct gccgccgccc taccccggct cgtcgcaagc gcagggaggc ccgttccaag 1261 ccagctcgcc ctcctaccac ctgtacTACG GCGCCTCGGC CGGCTCCTAC CAGTTCTCCA 1321 TGGTGGGCGG CGAGCGCTCG CCGCCGCGCA TCCTGCCGCC CTGCACCAAC GCCTCCACCG 1381 GCTCCGCGCT GCTCAACCCC AGCCTCCCGA ACCAGAGCGA CGTGGTGGAG GCCGAGGGCA 1441 GCCACAGCAA CTCCCCCACC AACATGGCGC CCTCCGCGCG CCTGGAGGAG GCCGTGTGGA 1501 GGCCCTACTT GCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1561 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1621 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAATTTCT AGGCCACCTC GTTGAGCAAC 1681 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt