Transcript: Mouse NM_001111268.1

Mus musculus glutamate receptor, ionotropic, kainate 2 (beta 2) (Grik2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Grik2 (14806)
Length:
4785
CDS:
414..3140

Additional Resources:

NCBI RefSeq record:
NM_001111268.1
NBCI Gene record:
Grik2 (14806)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001111268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100274 CGTTTATGACTCTTGGAATAA pLKO.1 2008 CDS 100% 13.200 10.560 N Grik2 n/a
2 TRCN0000100271 GCCGTTTATGACTCTTGGAAT pLKO.1 2006 CDS 100% 4.950 3.960 N Grik2 n/a
3 TRCN0000100272 CCTCCGATTATGCTTTCTTAA pLKO.1 2602 CDS 100% 13.200 9.240 N Grik2 n/a
4 TRCN0000100273 GCATTCAGATTTGCTGTGAAT pLKO.1 579 CDS 100% 0.495 0.347 N Grik2 n/a
5 TRCN0000100270 GTTATCAACATGCACACATTT pLKO.1 3081 CDS 100% 13.200 7.920 N Grik2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001111268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13864 pDONR223 100% 58.6% 62.6% None (many diffs) n/a
2 ccsbBroad304_13864 pLX_304 0% 58.6% 62.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471328 TCAAACTAGATTACAATTCGATTC pLX_317 18.9% 58.6% 62.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_10863 pDONR223 100% 33.4% 34.1% None (many diffs) n/a
5 ccsbBroad304_10863 pLX_304 0% 33.4% 34.1% V5 (many diffs) n/a
6 TRCN0000471009 TTGCTGATAGATCAATTCTGAAGC pLX_317 31.6% 33.4% 34.1% V5 (many diffs) n/a
Download CSV