Construct: ORF TRCN0000471328
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000917.1_s317c1
- Derived from:
- ccsbBroadEn_13864
- DNA Barcode:
- TCAAACTAGATTACAATTCGATTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- GRIK2 (2898)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471328
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XM_017010782.2 | 96.8% | 96.5% | 1740delC;1749_1803delinsG |
| 2 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XM_017010781.2 | 82.4% | 82% | 1740delC;1750_2121del |
| 3 | human | 2898 | GRIK2 | glutamate ionotropic recept... | NM_175768.3 | 67% | 66.7% | 1740delC;1750_2607del |
| 4 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XM_024446411.1 | 67% | 66.7% | 1740delC;1750_2607del |
| 5 | human | 2898 | GRIK2 | glutamate ionotropic recept... | NM_001166247.1 | 65.3% | 65% | 1740delC;1750_2676del |
| 6 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XM_011535777.3 | 65.3% | 65% | 1740delC;1750_2676del |
| 7 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XM_024446410.1 | 65.3% | 65% | 1740delC;1750_2676del |
| 8 | human | 2898 | GRIK2 | glutamate ionotropic recept... | NM_021956.4 | 64.1% | 63.8% | 1740delC;1750_2724del |
| 9 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XM_005266945.2 | 64.1% | 63.8% | 1740delC;1750_2724del |
| 10 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XM_005266946.4 | 58.7% | 58.4% | 0_1ins147;1593delC;1603_2577del |
| 11 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XR_002956278.1 | 35.4% | 1_423del;2163delC;2173_4935del | |
| 12 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_011243127.2 | 84.5% | 90.6% | (many diffs) |
| 13 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | NM_010349.2 | 61.2% | 65.4% | (many diffs) |
| 14 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_006512545.3 | 59.6% | 63.9% | (many diffs) |
| 15 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_011243124.2 | 58.9% | 63.1% | (many diffs) |
| 16 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_011243125.2 | 58.9% | 63.1% | (many diffs) |
| 17 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_017313804.1 | 58.6% | 62.8% | (many diffs) |
| 18 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | NM_001111268.1 | 58.6% | 62.6% | (many diffs) |
| 19 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_011243123.2 | 57.3% | 61.5% | (many diffs) |
| 20 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_011243120.2 | 56.4% | 60.5% | (many diffs) |
| 21 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_011243121.2 | 56.4% | 60.5% | (many diffs) |
| 22 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_011243122.2 | 56.4% | 60.5% | (many diffs) |
| 23 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XR_001779465.1 | 53.2% | (many diffs) | |
| 24 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XR_001779464.1 | 47.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1806
- ORF length:
- 1740
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gattattttc ccgattctaa gtaatccagt cttcaggcgc accgttaaac 121 tcctgctctg tttactgtgg attggatatt ctcaaggaac cacacatgta ttaagatttg 181 gtggtatttt tgaatatgtg gaatctggcc caatgggagc tgaggaactt gcattcagat 241 ttgctgtgaa cacaattaac agaaacagaa cattgctacc caatactacc cttacctatg 301 atacccagaa gataaacctt tatgatagtt ttgaagcatc caagaaagcc tgtgatcagc 361 tgtctcttgg ggtggctgcc atcttcgggc cttcacacag ctcatcagca aacgcagtgc 421 agtccatctg caatgctctg ggagttcccc acatacagac ccgctggaag caccaggtgt 481 cagacaacaa agattccttc tatgtcagtc tctacccaga cttctcttca ctcagccgtg 541 ccattttaga cctggtgcag tttttcaagt ggaaaaccgt cacggttgtg tatgatgaca 601 gcactggtct cattcgtttg caagagctca tcaaagctcc atcaaggtat aatcttcgac 661 tcaaaattcg tcagttacct gctgatacaa aggatgcaaa acccttacta aaagaaatga 721 aaagaggcaa ggagtttcat gtaatctttg attgtagcca tgaaatggca gcaggcattt 781 taaaacaggc attagctatg ggaatgatga cagaatacta tcattatatc tttaccactc 841 tggacctctt tgctcttgat gttgagccct accgatacag tggtgttaac atgacagggt 901 tcagaatatt aaatacagaa aatacccaag tctcctccat cattgaaaag tggtcgatgg 961 aacgattgca ggcacctccg aaacccgatt caggtttgct ggatggattt atgacgactg 1021 atgctgctct aatgtatgat gctgtgcatg tggtgtctgt ggccgttcaa cagtttcccc 1081 agatgacagt cagttccttg cagtgtaatc gacataaacc ctggcgcttc gggacccgct 1141 ttatgagtct aattaaagag gcacattggg aaggcctcac aggcagaata actttcaaca 1201 aaaccaatgg cttgagaaca gattttgatt tggatgtgat cagtctgaag gaagaaggtc 1261 tagaaaagat tggaacgtgg gatccagcca gtggcctgaa tatgacagaa agtcaaaagg 1321 gaaagccagc gaacatcaca gattccttat ccaatcgttc tttgattgtt accaccattt 1381 tggaagagcc ttatgtcctt tttaagaagt ctgacaaacc tctctatggt aatgatcgat 1441 ttgaaggcta ttgcattgat ctcctcagag agttatctac aatccttggC TTTACATATG 1501 AAATTAGACT TGTGGAAGAT GGGAAATATG GAGCCCAGGA TGATGCCAAT GGACAATGGA 1561 ATGGAATGGT TCGTGAACTA ATTGATCATA AAGCTGACCT TGCAGTTGCT CCACTGGCTA 1621 TTACCTATGT TCGAGAGAAG GTCATCGACT TTTCCAAGCC CTTTATGACA CTTGGAATAA 1681 GTATTTTGTA CCGCAAGCCC AATGGTACAA ACCCAGGCGT CTTCTCCTTC CTGAATCCTC 1741 TCTCCCCTGA TATCTGGATG TATATTCTGC TGGCTTACTT GGGTGTCAGT TGTGTGCTCT 1801 TTGTATAGCC AGGTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC 1861 TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT 1921 TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT CAAACTAGAT TACAATTCGA 1981 TTCACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag att