Construct: ORF TRCN0000471009
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013548.1_s317c1
- Derived from:
- ccsbBroadEn_10863
- DNA Barcode:
- TTGCTGATAGATCAATTCTGAAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GRIK2 (2898)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471009
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XM_017010782.2 | 56.4% | 52.3% | (many diffs) |
| 2 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XM_017010781.2 | 47.9% | 44.6% | (many diffs) |
| 3 | human | 2898 | GRIK2 | glutamate ionotropic recept... | NM_175768.3 | 39% | 36.4% | (many diffs) |
| 4 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XM_024446411.1 | 39% | 36.4% | (many diffs) |
| 5 | human | 2898 | GRIK2 | glutamate ionotropic recept... | NM_001166247.1 | 38% | 35.5% | (many diffs) |
| 6 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XM_011535777.3 | 38% | 35.5% | (many diffs) |
| 7 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XM_024446410.1 | 38% | 35.5% | (many diffs) |
| 8 | human | 2898 | GRIK2 | glutamate ionotropic recept... | NM_021956.4 | 37.3% | 34.9% | (many diffs) |
| 9 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XM_005266945.2 | 37.3% | 34.9% | (many diffs) |
| 10 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XM_005266946.4 | 32% | 29.6% | (many diffs) |
| 11 | human | 2898 | GRIK2 | glutamate ionotropic recept... | XR_002956278.1 | 20.6% | (many diffs) | |
| 12 | human | 7576 | ZNF28 | zinc finger protein 28 | NM_001369767.1 | 7.6% | 1.9% | (many diffs) |
| 13 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_011243127.2 | 48.1% | 48.9% | (many diffs) |
| 14 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | NM_010349.2 | 34.9% | 35.6% | (many diffs) |
| 15 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_006512545.3 | 34% | 34.7% | (many diffs) |
| 16 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_011243124.2 | 33.6% | 34.3% | (many diffs) |
| 17 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_011243125.2 | 33.6% | 34.3% | (many diffs) |
| 18 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | NM_001111268.1 | 33.4% | 34.1% | (many diffs) |
| 19 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_017313804.1 | 33.4% | 34.1% | (many diffs) |
| 20 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_011243123.2 | 32.7% | 33.4% | (many diffs) |
| 21 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_011243120.2 | 32.2% | 32.9% | (many diffs) |
| 22 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_011243121.2 | 32.2% | 32.9% | (many diffs) |
| 23 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XM_011243122.2 | 32.2% | 32.9% | (many diffs) |
| 24 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XR_001779465.1 | 30.4% | (many diffs) | |
| 25 | mouse | 14806 | Grik2 | glutamate receptor, ionotro... | XR_001779464.1 | 27.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1125
- ORF length:
- 1059
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gattattttc ccgattctaa gtaatccagt cttcaggcgc accgttaaac 121 tcctgctctg tttactgtgg attggatatt ctcaaggaac cacacatgta ttaagatttg 181 gtggtatttt tgaatatgtg gaatctggcc caatgggagc tgaggaactt gcattcagat 241 ttgctgtgaa cacaattaac agaaacagaa cattgctacc caatactacc cttacctatg 301 atacccagaa gataaacctt tatgatagtt ttgaagcatc caagaaagcc tgtgatcagc 361 tgtctcttgg ggtggctgcc atcttcgggc cttcacacag ctcatcagca aacgcagtgc 421 agtccatctg caatgctctg ggagttcccc acatacagac ccgctggaag caccaggtgt 481 cagacaacaa agattccttc tatgtcagtc tctacccaga cttctcttca ctcagccgtg 541 ccattttaga cctggtgcag tttttcaagt ggaaaaccgt cacggttgtg tatgatgaca 601 gcactggtct cattcgtttg caagagctca tcaaagctcc atcaaggtat aatcttcgac 661 tcaaaattcg tcagttacct gctgatacaa aggatgcaaa acccttacta aaagaaatga 721 aaagaggcaa ggagtttcat gtaatctttg attgtagcca tgaaatggca gcaggcattt 781 taaaacaggc attAGCTATG GGAATGATGA CAGAATACTA TCATTATATC TTTACCACTC 841 TGGACCTCTT TGCTCTTGAT GTTGAGCCCT ACCGATACAG TGGTGTTAAC ATGACAGGGT 901 TCAGAATATT AAATACAGAA AATACCCAAG TCTCCTCCAT CATTGAAAAG TGGTCGATGG 961 AACGATTGCA GGCACCTCCG AAACCCGATT CAGGTTTGCT GGATGGATTT ATGACGATGG 1021 AGTTTCACTC TTGTTGCCCA GGCTGGAGTG CAATGGCGCG ATCTCACCTC ACTGCAACCT 1081 CTGCCTCCTG GGTTCAAGCG ATTCTTCTGC CTCAGCCTCC CGAGTACCCA ACTTTCTTGT 1141 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1201 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1261 GAAAGGACGA TTGCTGATAG ATCAATTCTG AAGCACGCGT TAAGTCgaca atcaacctct 1321 ggattacaaa atttgtgaaa gatt