Transcript: Mouse NM_001113517.1

Mus musculus Rho guanine nucleotide exchange factor (GEF7) (Arhgef7), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Arhgef7 (54126)
Length:
4946
CDS:
148..2496

Additional Resources:

NCBI RefSeq record:
NM_001113517.1
NBCI Gene record:
Arhgef7 (54126)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110028 GCCCTCCCAAAGGGTTCGATA pLKO.1 854 CDS 100% 1.650 2.310 N Arhgef7 n/a
2 TRCN0000303860 AGAGACACATGGAGGATTATC pLKO_005 1346 CDS 100% 13.200 9.240 N ARHGEF7 n/a
3 TRCN0000305803 AGAGACACATGGAGGATTATC pLKO_005 1346 CDS 100% 13.200 9.240 N Arhgef7 n/a
4 TRCN0000110026 CCTGAAGGTTATCGAAGCTTA pLKO.1 2223 CDS 100% 4.950 3.465 N Arhgef7 n/a
5 TRCN0000110027 GAAGTCTATGACGGCCTTCAA pLKO.1 1389 CDS 100% 4.950 3.465 N Arhgef7 n/a
6 TRCN0000353879 GAAGTCTATGACGGCCTTCAA pLKO_005 1389 CDS 100% 4.950 3.465 N Arhgef7 n/a
7 TRCN0000110029 CAGATCCTGAAGGTTATCGAA pLKO.1 2218 CDS 100% 3.000 2.100 N Arhgef7 n/a
8 TRCN0000324966 CAGATCCTGAAGGTTATCGAA pLKO_005 2218 CDS 100% 3.000 2.100 N Arhgef7 n/a
9 TRCN0000047597 CTCTGCTACAAGGAGGATCTT pLKO.1 2083 CDS 100% 4.950 3.465 N ARHGEF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02036 pDONR223 100% 84.8% 92% None (many diffs) n/a
2 ccsbBroad304_02036 pLX_304 0% 84.8% 92% V5 (many diffs) n/a
3 TRCN0000479549 CAGCCCGAGTTGTATTTCACCCGA pLX_317 16% 84.8% 92% V5 (many diffs) n/a
4 ccsbBroadEn_07317 pDONR223 100% 83.6% 90.6% None (many diffs) n/a
5 ccsbBroad304_07317 pLX_304 0% 83.6% 90.6% V5 (many diffs) n/a
6 TRCN0000474600 ATGTATAGCGCCCTCCCCCCGCCC pLX_317 16.8% 83.6% 90.6% V5 (many diffs) n/a
Download CSV