Construct: ORF TRCN0000474600
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009045.1_s317c1
- Derived from:
- ccsbBroadEn_07317
- DNA Barcode:
- ATGTATAGCGCCCTCCCCCCGCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGEF7 (8874)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474600
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001113512.2 | 99.8% | 99.6% | 877C>A;1504A>G;2068A>T |
| 2 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_145735.3 | 96.1% | 95.9% | (many diffs) |
| 3 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020814.1 | 94.7% | 94.4% | (many diffs) |
| 4 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001113511.2 | 93.6% | 93.3% | (many diffs) |
| 5 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354047.1 | 92.8% | 90.7% | (many diffs) |
| 6 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001320852.1 | 86.7% | 85% | (many diffs) |
| 7 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354046.1 | 86.7% | 85.1% | (many diffs) |
| 8 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_006719956.3 | 85.5% | 83.8% | (many diffs) |
| 9 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001320853.2 | 83.2% | 81.3% | (many diffs) |
| 10 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001330597.2 | 82.8% | 82.6% | (many diffs) |
| 11 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001330598.2 | 82.8% | 82.6% | (many diffs) |
| 12 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354056.1 | 82.8% | 82.6% | (many diffs) |
| 13 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354057.2 | 82.8% | 82.6% | (many diffs) |
| 14 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354058.2 | 82.8% | 82.6% | (many diffs) |
| 15 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354059.2 | 82.8% | 82.6% | (many diffs) |
| 16 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354060.2 | 82.8% | 82.6% | (many diffs) |
| 17 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020815.1 | 82% | 78.5% | (many diffs) |
| 18 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020816.1 | 82% | 80% | (many diffs) |
| 19 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354048.1 | 74.4% | 72.8% | (many diffs) |
| 20 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354049.2 | 74.4% | 72.8% | (many diffs) |
| 21 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354050.2 | 74.4% | 72.8% | (many diffs) |
| 22 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354051.2 | 74.4% | 72.8% | (many diffs) |
| 23 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001113513.2 | 73.8% | 71.8% | (many diffs) |
| 24 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001320851.2 | 73.8% | 71.8% | (many diffs) |
| 25 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354052.2 | 73.8% | 71.8% | (many diffs) |
| 26 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354053.2 | 73.8% | 71.8% | (many diffs) |
| 27 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_003899.5 | 73.8% | 71.8% | (many diffs) |
| 28 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354054.2 | 72.7% | 70.7% | (many diffs) |
| 29 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020819.1 | 72.7% | 70.7% | (many diffs) |
| 30 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020820.1 | 72.7% | 70.7% | (many diffs) |
| 31 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020821.2 | 72.7% | 70.7% | (many diffs) |
| 32 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020822.1 | 72.7% | 70.7% | (many diffs) |
| 33 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020823.2 | 72.7% | 70.7% | (many diffs) |
| 34 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_024449428.1 | 72.7% | 70.7% | (many diffs) |
| 35 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001320854.2 | 72% | 70.1% | (many diffs) |
| 36 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XR_001749712.1 | 69.6% | (many diffs) | |
| 37 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354055.2 | 64.6% | 61.7% | (many diffs) |
| 38 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354061.2 | 62.1% | 61.6% | (many diffs) |
| 39 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020829.2 | 62.1% | 61.6% | (many diffs) |
| 40 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_011521133.2 | 60.6% | 60.4% | (many diffs) |
| 41 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020828.1 | 53.7% | 50.8% | (many diffs) |
| 42 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XR_002957481.1 | 39.6% | (many diffs) | |
| 43 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | NM_001113517.1 | 83.6% | 90.6% | (many diffs) |
| 44 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | XM_006508843.3 | 76.3% | 80.3% | (many diffs) |
| 45 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | XM_006508841.2 | 75% | 80.4% | (many diffs) |
| 46 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | XM_006508845.3 | 71.8% | 76.9% | (many diffs) |
| 47 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | XM_006508844.2 | 67.4% | 72.2% | (many diffs) |
| 48 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | NM_001113518.1 | 64.1% | 68.5% | (many diffs) |
| 49 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | XM_017312901.1 | 62.7% | 66% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2325
- ORF length:
- 2259
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ttccgccgag caaaccgtta cgtggctcat cactctgggg gtgctggagt 121 cgcccaaaaa aaccatctcg gacccggagg gctttctgca ggcgtcgctg aaggatgggg 181 tggtcctctg caggctgctg gagcgcctgc tccccgggac catcgagaaa acgtttgatg 241 caaatgattt gtatcagggg cagaatttta acaaggtcct cagttcctta gtgactctaa 301 ataaagtaac agcagacatc gggctgggga gtgactccgt gtgtgcccgg ccctcgtctc 361 accgcataaa gtcttttgac tcccttggat cacagtcttt gcacactcgg acttcaaaac 421 tgttccaggg ccagtatcgg agtttggaca tgaccgataa tagcaacaat caactggtag 481 taagagcaaa gtttaacttc cagcagacca atgaggacga gctttccttc tcaaaaggag 541 acgtcatcca tgtcacccgt gtggaagagg gaggctggtg ggagggcaca ctcaacggcc 601 ggaccggctg gttccccagc aactacgtgc gcgaggtcaa ggccagcgag aagcctgtgt 661 ctcccaaatc aggaacactg aagagccctc ccaaaggatt tgatacgact gccataaaca 721 aaagctatta caatgtggtg ctacagaata ttttagaaac agaaaatgaa tattctaaag 781 aacttcagac tgtgctttca acgtacctac ggccattgca gaccagtgag aagttaagtt 841 cagcaaacat ttcatattta atgggaaatc tagaagaaat atgttctttc cagcaaatgc 901 tcgtacagtc tttagaagaa tgcaccaagt tgcccgaagc taagcagaga gtcggaggct 961 gctttttaaa cctgatgcca cagatgaaaa ccctgtacct cacgtattgt gccaatcacc 1021 cttctgcagt gaatgtcctc acggaacaca gtgaggagtt gggggagttc atggagacca 1081 aaggtgccag cagccctggg attctcgtgc tgaccacggg cctgagcaaa cccttcatgc 1141 gcctggataa ataccctacg ctgctcaaag agctcgagag acacatggag gattatcata 1201 cagatagaca agatattcaa aaatccatgg ctgccttcaa aaacctttca gcccaatgtc 1261 aagaagtccg gaagaggaaa gagcttgagc tgcagatcct gacggaagcc atccggaact 1321 gggagggcga tgacattaaa actctgggca acgtcactta catgtcccag gtcctgattc 1381 agtgtgccgg aagtgaggaa aagaatgaaa gatatcttct actcttccca aatgttttgc 1441 taatgttgtc tgccagtcct aggatgagtg gctttatcta tcagggaaag cttccaacga 1501 caggaatgac aatcacaaag cttgaggaca gtgaaaatca tagaaatgca tttgaaatat 1561 cagggagcgt gattgagcgg atattagtgt cgtgcaacaa ccagcaggat ctgcaggaat 1621 gggtggagca cctacagaag caaacgaagg tcacgtctgt gggaaacccc accataaagc 1681 ctcattcagt gccatctcat accctcccct cccacccggt cactccgtcc agcaagcacg 1741 cagacagcaa gcccgcgccg ctgacgcccg cctaccacac gctgccccac ccctcccacc 1801 acggcacccc gcacaccacc atcaactggg gacccctgga gcctccgaaa acacccaagc 1861 cctggagcct gagctgcctg cggcccgcgc ctcccctccg gccctcagct gctctctgct 1921 acaaggagga tcttagtaag agccctaaga CCATGAAAAA GCTGCTGCCC AAGCGCAAAC 1981 CTGAACGGAA GCCTTCAGAT GAGGAGTTCG CGTCCCGGAA AAGCACAGCT GCTTTGGAAG 2041 AAGATGCTCA GATTCTGAAA GTCATTGAAG CTTACTGCAC CAGCGCCAAA ACAAGGCAAA 2101 CACTCAATTC AACATGGCAA GGCACTGACC TGTTGCATAA TCACGTCTTG GCTGATGATG 2161 ACCAACCAAG CCTAGACTCC CTGGGGCGTC GCAGTAGCCT TTCTCGTTTG GAGCCTTCAG 2221 ACCTCTCGGA AGACTCTGAC TATGACAGTA TATGGACAGC CCATAGTTAC AGAATGGGTT 2281 CTACATCTCG TAAGAGCTGT TGCTCATATA TCTCTCACCA GAACTACCCA ACTTTCTTGT 2341 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 2401 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 2461 GAAAGGACGA ATGTATAGCG CCCTCCCCCC GCCCACGCGT TAAGTCgaca atcaacctct 2521 ggattacaaa atttgtgaaa gatt