Construct: ORF TRCN0000479549
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018363.1_s317c1
- Derived from:
- ccsbBroadEn_02036
- DNA Barcode:
- CAGCCCGAGTTGTATTTCACCCGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGEF7 (8874)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479549
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001113511.2 | 100% | 100% | |
| 2 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_145735.3 | 97.3% | 97.3% | 252_253ins63 |
| 3 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020814.1 | 95.9% | 95.9% | 252_253ins63;1950_1985del |
| 4 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001113512.2 | 93.7% | 93.7% | 165_166ins150 |
| 5 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354047.1 | 88.4% | 88.4% | 251_252ins279 |
| 6 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001320852.1 | 88.1% | 86.6% | (many diffs) |
| 7 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354046.1 | 88% | 86.7% | (many diffs) |
| 8 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_006719956.3 | 86.8% | 85.4% | (many diffs) |
| 9 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020815.1 | 78.5% | 76.8% | (many diffs) |
| 10 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001320853.2 | 78.1% | 76.5% | (many diffs) |
| 11 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001330597.2 | 77.8% | 77.8% | 0_1ins534 |
| 12 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001330598.2 | 77.8% | 77.8% | 0_1ins534 |
| 13 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354056.1 | 77.8% | 77.8% | 0_1ins534 |
| 14 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354057.2 | 77.8% | 77.8% | 0_1ins534 |
| 15 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354058.2 | 77.8% | 77.8% | 0_1ins534 |
| 16 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354059.2 | 77.8% | 77.8% | 0_1ins534 |
| 17 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354060.2 | 77.8% | 77.8% | 0_1ins534 |
| 18 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020816.1 | 77% | 75.4% | (many diffs) |
| 19 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XR_001749712.1 | 71.4% | (many diffs) | |
| 20 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354048.1 | 70.3% | 69.1% | (many diffs) |
| 21 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354049.2 | 70.3% | 69.1% | (many diffs) |
| 22 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354050.2 | 70.3% | 69.1% | (many diffs) |
| 23 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354051.2 | 70.3% | 69.1% | (many diffs) |
| 24 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001113513.2 | 69.6% | 67.7% | (many diffs) |
| 25 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001320851.2 | 69.6% | 67.7% | (many diffs) |
| 26 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354052.2 | 69.6% | 67.7% | (many diffs) |
| 27 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354053.2 | 69.6% | 67.7% | (many diffs) |
| 28 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_003899.5 | 69.6% | 67.7% | (many diffs) |
| 29 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354054.2 | 68.6% | 66.7% | (many diffs) |
| 30 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020819.1 | 68.6% | 66.7% | (many diffs) |
| 31 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020820.1 | 68.6% | 66.7% | (many diffs) |
| 32 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020821.2 | 68.6% | 66.7% | (many diffs) |
| 33 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020822.1 | 68.6% | 66.7% | (many diffs) |
| 34 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020823.2 | 68.6% | 66.7% | (many diffs) |
| 35 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_024449428.1 | 68.6% | 66.7% | (many diffs) |
| 36 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001320854.2 | 67.7% | 66.2% | (many diffs) |
| 37 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_011521133.2 | 62.7% | 62.6% | 252_253ins63;1508_1509insAA;1512_1512delAins833 |
| 38 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354055.2 | 61.1% | 58.6% | (many diffs) |
| 39 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | NM_001354061.2 | 58.5% | 58.1% | 0_1ins965;49_107del |
| 40 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020829.2 | 58.5% | 58.1% | 0_1ins965;49_107del |
| 41 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XM_017020828.1 | 50.7% | 48.1% | (many diffs) |
| 42 | human | 8874 | ARHGEF7 | Rho guanine nucleotide exch... | XR_002957481.1 | 39% | (many diffs) | |
| 43 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | NM_001113517.1 | 84.8% | 92% | (many diffs) |
| 44 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | XM_006508843.3 | 77.9% | 81.8% | (many diffs) |
| 45 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | XM_006508841.2 | 76.3% | 81.9% | (many diffs) |
| 46 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | XM_006508844.2 | 68.9% | 73.9% | (many diffs) |
| 47 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | XM_006508845.3 | 67.6% | 72.8% | (many diffs) |
| 48 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | NM_017402.4 | 61.3% | 63.7% | (many diffs) |
| 49 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | NM_001113518.1 | 60.6% | 65% | (many diffs) |
| 50 | mouse | 54126 | Arhgef7 | Rho guanine nucleotide exch... | XM_017312901.1 | 58.9% | 62.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2475
- ORF length:
- 2409
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ttccgccgag caaaccgtta cgtggctcat cactctgggg gtgctggagt 121 cgcccaaaaa aaccatctcg gacccggagg gctttctgca ggcgtcgctg aaggatgggg 181 tggtcctctg caggctgctg gagcgcctgc tccccgggac catcgagaaa gtctaccccg 241 agccccggag cgagagcgag tgcctgagca acatccgcga gttcctgcgc ggctgcgggg 301 cttccctgcg gctggagctc ctgtttcctc cttcccagcc tcctcagcat ctggtaacca 361 ccattctctt gtctgcttct acgtttgatg caaatgattt gtatcagggg cagaatttta 421 acaaggtcct cagttcctta gtgactctaa ataaagtaac agcagacatc gggctgggga 481 gtgactccgt gtgtgcccgg ccctcgtctc accgcataaa gtcttttgac tcccttggat 541 cacagtcttt gcacactcgg acttcaaaac tgttccaggg ccagtatcgg agtttggaca 601 tgaccgataa tagcaacaat caactggtag taagagcaaa gtttaacttc cagcagacca 661 atgaggacga gctttccttc tcaaaaggag acgtcatcca tgtcacccgt gtggaagagg 721 gaggctggtg ggagggcaca ctcaacggcc ggaccggctg gttccccagc aactacgtgc 781 gcgaggtcaa ggccagcgag aagcctgtgt ctcccaaatc aggaacactg aagagccctc 841 ccaaaggatt tgatacgact gccataaaca aaagctatta caatgtggtg ctacagaata 901 ttttagaaac agaaaatgaa tattctaaag aacttcagac tgtgctttca acgtacctac 961 ggccattgca gaccagtgag aagttaagtt cagcaaacat ttcatattta atgggaaatc 1021 tagaagaaat atgttctttc cagcaaatgc tcgtacagtc tttagaagaa tgcaccaagt 1081 tgcccgaagc tcagcagaga gtcggaggct gctttttaaa cctgatgcca cagatgaaaa 1141 ccctgtacct cacgtattgt gccaatcacc cttctgcagt gaatgtcctc acggaacaca 1201 gtgaggagtt gggggagttc atggagacca aaggtgccag cagccctggg attctcgtgc 1261 tgaccacggg cctgagcaaa cccttcatgc gcctggataa ataccctacg ctgctcaaag 1321 agctcgagag acacatggag gattatcata cagatagaca agatattcaa aaatccatgg 1381 ctgccttcaa aaacctttca gcccaatgtc aagaagtccg gaagaggaaa gagcttgagc 1441 tgcagatcct gacggaagcc atccggaact gggagggcga tgacattaaa actctgggca 1501 acgtcactta catgtcccag gtcctgattc agtgtgccgg aagtgaggaa aagaatgaaa 1561 gatatcttct actcttccca aatgttttgc taatgttgtc tgccagtcct aggatgagtg 1621 gctttatcta tcagggaaag cttccaacga caggaatgac aatcacaaag cttgaggaca 1681 gtgaaaatca tagaaatgca tttgaaatat cagggagcat gattgagcgg atattagtgt 1741 cgtgcaacaa ccagcaggat ctgcaggaat gggtggagca cctacagaag caaacgaagg 1801 tcacgtctgt gggaaacccc accataaagc ctcattcagt gccatctcat accctcccct 1861 cccacccggt cactccgtcc agcaagcacg cagacagcaa gcccgcgccg ctgacgcccg 1921 cctaccacac gctgccccac ccctcccacc acggcacccc gcacaccacc atcaactggg 1981 gacccctgga gcctccgaaa acacccaagc cctggagcct gagctgcctg cggcccgcgc 2041 ctcccctccg gccctcagct gctctctgct acaaggagga tcttagtaag agcccTAAGA 2101 CCATGAAAAA GCTGCTGCCC AAGCGCAAAC CTGAACGGAA GCCTTCAGAT GAGGAGTTCG 2161 CGTCCCGGAA AAGCACAGCT GCTTTGGAAG AAGATGCTCA GATTCTGAAA GTCATTGAAG 2221 CTTACTGCAC CAGCGCCAAA ACAAGGCAAA CACTCAATTC AACATGGCAA GGCACTGACC 2281 TGATGCATAA TCACGTCTTG GCTGATGATG ACCAACCAAG CCTAGACTCC CTGGGGCGTC 2341 GCAGTAGCCT TTCTCGTTTG GAGCCTTCAG ACCTCTCGGA AGACTCTGAC TATGACAGTA 2401 TATGGACAGC CCATAGTTAC AGAATGGGTT CTACATCTCG TAAGAGCTGT TGCTCATATA 2461 TCTCTCACCA GAACTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 2521 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 2581 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CAGCCCGAGT TGTATTTCAC 2641 CCGAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt