Transcript: Human NM_001114619.1

Homo sapiens alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase (MGAT1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
MGAT1 (4245)
Length:
2658
CDS:
217..1554

Additional Resources:

NCBI RefSeq record:
NM_001114619.1
NBCI Gene record:
MGAT1 (4245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001114619.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294494 CTATGATCCTAGCTGGAATTA pLKO_005 1533 CDS 100% 13.200 18.480 N MGAT1 n/a
2 TRCN0000035194 CCGGACTTCTTCGAGTACTTT pLKO.1 862 CDS 100% 5.625 7.875 N MGAT1 n/a
3 TRCN0000315891 CCGGACTTCTTCGAGTACTTT pLKO_005 862 CDS 100% 5.625 7.875 N MGAT1 n/a
4 TRCN0000035196 CCCTGAGATCTCAAGAACGAT pLKO.1 1131 CDS 100% 3.000 2.100 N MGAT1 n/a
5 TRCN0000315892 CCCTGAGATCTCAAGAACGAT pLKO_005 1131 CDS 100% 3.000 2.100 N MGAT1 n/a
6 TRCN0000035198 GCACCTCAAGTTTATCAAGCT pLKO.1 1197 CDS 100% 2.640 1.848 N MGAT1 n/a
7 TRCN0000315814 GCACCTCAAGTTTATCAAGCT pLKO_005 1197 CDS 100% 2.640 1.848 N MGAT1 n/a
8 TRCN0000035197 CCACCGCAAGTTCCAGGGCTA pLKO.1 741 CDS 100% 0.000 0.000 N MGAT1 n/a
9 TRCN0000018455 GCTATGATCCTAGCTGGAATT pLKO.1 1532 CDS 100% 0.000 0.000 N Mgat1 n/a
10 TRCN0000035195 CTGGACAAGCTGCTGCATTAT pLKO.1 580 CDS 100% 13.200 7.920 N MGAT1 n/a
11 TRCN0000294495 GTGGCATTTAAGTGCACAAAT pLKO_005 1681 3UTR 100% 13.200 7.920 N MGAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114619.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06580 pDONR223 100% 99.9% 99.7% None 1304T>C n/a
2 ccsbBroad304_06580 pLX_304 0% 99.9% 99.7% V5 (not translated due to frame shift) 1304T>C n/a
3 TRCN0000465593 AGTATCACGGCTATGGGTACTGAC pLX_317 26.5% 99.9% 99.7% V5 (not translated due to frame shift) 1304T>C n/a
Download CSV