Transcript: Mouse NM_001122948.2

Mus musculus transcription factor AP-2, alpha (Tfap2a), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Tfap2a (21418)
Length:
3500
CDS:
393..1688

Additional Resources:

NCBI RefSeq record:
NM_001122948.2
NBCI Gene record:
Tfap2a (21418)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001122948.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321210 ACGTAGAAGACCCGGGTATTA pLKO_005 856 CDS 100% 13.200 18.480 N Tfap2a n/a
2 TRCN0000321153 GCAAAGAGGATAATGACATTT pLKO_005 2157 3UTR 100% 13.200 18.480 N Tfap2a n/a
3 TRCN0000004923 CCGGGTATTAACATCCCAGAT pLKO.1 867 CDS 100% 4.050 5.670 N TFAP2A n/a
4 TRCN0000012050 CGGAGAGCGAAGTCTAAGAAT pLKO.1 1134 CDS 100% 5.625 4.500 N Tfap2a n/a
5 TRCN0000012051 GAGTTGCTTGACCCACTTCAA pLKO.1 1493 CDS 100% 4.950 3.960 N Tfap2a n/a
6 TRCN0000321143 GAGTTGCTTGACCCACTTCAA pLKO_005 1493 CDS 100% 4.950 3.960 N Tfap2a n/a
7 TRCN0000004925 CCCAGATCAAACTGTAATTAA pLKO.1 881 CDS 100% 15.000 10.500 N TFAP2A n/a
8 TRCN0000272665 CCCAGATCAAACTGTAATTAA pLKO_005 881 CDS 100% 15.000 10.500 N TFAP2A n/a
9 TRCN0000321211 TGTCTCCGCCATCCCTATTAA pLKO_005 941 CDS 100% 15.000 10.500 N Tfap2a n/a
10 TRCN0000012049 GCAGAATTTCTCAACCGACAA pLKO.1 1326 CDS 100% 4.050 2.835 N Tfap2a n/a
11 TRCN0000321209 GCAGAATTTCTCAACCGACAA pLKO_005 1326 CDS 100% 4.050 2.835 N Tfap2a n/a
12 TRCN0000012052 CGAAACTGAATTTCCTGCCAA pLKO.1 1298 CDS 100% 2.640 1.848 N Tfap2a n/a
13 TRCN0000012048 CCGCTGCCTACTCAGCGCCTT pLKO.1 1873 3UTR 100% 0.000 0.000 N Tfap2a n/a
14 TRCN0000272680 TCAGATTGTAGCCATACTTAA pLKO_005 2126 3UTR 100% 13.200 18.480 N TFAP2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122948.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07050 pDONR223 100% 94.3% 98.6% None (many diffs) n/a
2 ccsbBroad304_07050 pLX_304 0% 94.3% 98.6% V5 (many diffs) n/a
3 TRCN0000481607 GAGGAAGGTATGTCTCAAGAGCCT pLX_317 37.3% 94.3% 98.6% V5 (many diffs) n/a
Download CSV