Transcript: Human NM_001128165.1

Homo sapiens fibulin 7 (FBLN7), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-23
Taxon:
Homo sapiens (human)
Gene:
FBLN7 (129804)
Length:
2191
CDS:
272..1453

Additional Resources:

NCBI RefSeq record:
NM_001128165.1
NBCI Gene record:
FBLN7 (129804)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421808 GGACGTCGACATGTCGGAATA pLKO_005 1363 CDS 100% 10.800 15.120 N FBLN7 n/a
2 TRCN0000053944 CGGCAATGTGAGCTACGTGAA pLKO.1 1048 CDS 100% 4.050 5.670 N FBLN7 n/a
3 TRCN0000174242 CGGCAATGTGAGCTACGTGAA pLKO.1 1048 CDS 100% 4.050 5.670 N FBLN7 n/a
4 TRCN0000416441 AGTTTGGAAGCAAGTACTTAG pLKO_005 546 CDS 100% 10.800 7.560 N Fbln7 n/a
5 TRCN0000109554 CAAGACCATCTCCTTCCATTA pLKO.1 1135 CDS 100% 10.800 7.560 N Fbln7 n/a
6 TRCN0000053947 TCCCAGAACTGTCTCAGCAAA pLKO.1 341 CDS 100% 4.950 3.465 N FBLN7 n/a
7 TRCN0000053943 CGGCAGAAAGTTTGGAAGCAA pLKO.1 538 CDS 100% 3.000 2.100 N FBLN7 n/a
8 TRCN0000053945 GATGCATTTGTCCTCCAGGAA pLKO.1 747 CDS 100% 2.640 1.848 N FBLN7 n/a
9 TRCN0000053946 CCAAGACCATCTCCTTCCATT pLKO.1 1134 CDS 100% 4.950 2.970 N FBLN7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04855 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04855 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476735 TTCGGATTATGATGCACGAGTGCT pLX_317 35.9% 100% 100% V5 n/a
Download CSV